Human ABAT/GABA-AT/ GABAT ORF/cDNA clone-Lentivirus particle (NM_000663)

Pre-made Human ABAT/GABA-AT/ GABAT Lentiviral expression plasmid for ABAT lentivirus packaging, ABAT lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to ABAT/GABA-AT products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000658 Human ABAT Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000658
Gene Name ABAT
Accession Number NM_000663
Gene ID 18
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1503 bp
Gene Alias GABA-AT, GABAT, NPD009
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCTCCATGTTGCTCGCCCAGCGCCTGGCCTGCAGCTTCCAGCACAGCTACCGCCTGCTGGTGCCTGGATCCAGACACATTAGTCAAGCTGCAGCCAAAGTCGACGTTGAATTTGATTATGATGGGCCTCTGATGAAGACGGAAGTCCCAGGGCCTAGATCTCAGGAGTTAATGAAACAGCTGAATATAATTCAGAATGCAGAGGCTGTGCATTTTTTCTGCAATTACGAAGAGAGCCGAGGCAATTACCTGGTTGATGTGGACGGCAACCGAATGCTGGATCTTTATTCCCAGATCTCCTCTGTCCCCATAGGTTACAGCCACCCCGCCCTGCTGAAACTCATCCAACAGCCTCAAAATGCGAGCATGTTTGTCAACAGACCCGCCCTCGGAATCCTGCCTCCGGAGAACTTTGTGGAGAAGCTCCGGCAGTCCTTGCTCTCGGTGGCTCCCAAAGGGATGTCCCAGCTCATCACCATGGCCTGCGGCTCCTGCTCCAATGAAAACGCCTTAAAGACCATCTTCATGTGGTACCGGAGCAAGGAAAGAGGGCAGAGGGGCTTCTCCCAGGAGGAGCTGGAGACGTGCATGATTAACCAGGCCCCTGGCTGCCCCGACTACAGCATCCTCTCCTTCATGGGCGCGTTCCATGGGAGGACCATGGGTTGCTTAGCGACCACGCACTCTAAAGCCATTCACAAGATCGACATCCCTTCCTTTGACTGGCCCATCGCACCGTTCCCACGGCTGAAATACCCTCTGGAAGAGTTTGTGAAAGAGAACCAACAGGAGGAGGCCCGCTGTCTGGAAGAGGTGGAGGATCTGATTGTGAAATATCGGAAAAAGAAGAAGACGGTGGCCGGGATCATCGTGGAGCCCATCCAGTCCGAGGGTGGAGACAACCACGCATCCGATGACTTCTTTCGGAAGCTGAGAGACATCGCCAGGAAGCATGGCTGCGCCTTCTTGGTGGACGAGGTCCAGACCGGAGGAGGCTGCACGGGCAAGTTCTGGGCCCATGAGCACTGGGGCCTGGATGACCCAGCAGACGTGATGACCTTCAGCAAGAAGATGATGACTGGGGGCTTCTTCCACAAGGAGGAGTTCAGGCCTAATGCTCCCTACCGGATCTTCAACACCTGGCTGGGGGACCCGTCCAAGAACCTGTTGCTGGCTGAGGTCATCAACATCATCAAGCGGGAGGACCTGCTAAATAATGCAGCCCATGCCGGGAAGGCCCTGCTCACAGGACTGCTGGACCTCCAGGCCCGGTACCCCCAGTTCATCAGCAGGGTGAGAGGACGAGGCACCTTTTGCTCCTTCGATACTCCCGATGATTCCATACGGAATAAGCTCATTTTAATTGCCAGAAACAAAGGTGTGGTGTTGGGTGGCTGTGGTGACAAATCCATTCGTTTCCGTCCCACGCTGGTCTTCAGGGATCACCACGCTCACCTGTTCCTCAATATTTTCAGTGACATCTTAGCAGACTTCAAGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T59045-Ab Anti-ABAT monoclonal antibody
    Target Antigen GM-Tg-g-T59045-Ag ABAT protein
    ORF Viral Vector pGMLP000658 Human ABAT Lentivirus plasmid
    ORF Viral Vector vGMLP000658 Human ABAT Lentivirus particle


    Target information

    Target ID GM-T59045
    Target Name ABAT
    Gene ID 18, 268860, 714017, 81632, 101089064, 479856, 280969, 100051470
    Gene Symbol and Synonyms 9630038C02Rik,ABAT,beta-AlaAT,GABA-AT,GABA-T,Gabaat,GABAT,Gm9851,I54,L-AIBAT,Laibat,NPD009
    Uniprot Accession P80404
    Uniprot Entry Name GABT_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000183044
    Target Classification Not Available

    4-aminobutyrate aminotransferase (ABAT) is responsible for catabolism of gamma-aminobutyric acid (GABA), an important, mostly inhibitory neurotransmitter in the central nervous system, into succinic semialdehyde. The active enzyme is a homodimer of 50-kD subunits complexed to pyridoxal-5-phosphate. The protein sequence is over 95% similar to the pig protein. GABA is estimated to be present in nearly one-third of human synapses. ABAT in liver and brain is controlled by 2 codominant alleles with a frequency in a Caucasian population of 0.56 and 0.44. The ABAT deficiency phenotype includes psychomotor retardation, hypotonia, hyperreflexia, lethargy, refractory seizures, and EEG abnormalities. Multiple alternatively spliced transcript variants encoding the same protein isoform have been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.