Human IL12B/CLMF/ CLMF2 ORF/cDNA clone-Lentivirus particle (NM_002187)

Pre-made Human IL12B/CLMF/ CLMF2 Lentiviral expression plasmid for IL12B lentivirus packaging, IL12B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to IL12B/CLMF products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000740 Human IL12B Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000740
Gene Name IL12B
Accession Number NM_002187
Gene ID 3593
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 987 bp
Gene Alias CLMF, CLMF2, IL-12B, IMD28, IMD29, NKSF, NKSF2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTGTCACCAGCAGTTGGTCATCTCTTGGTTTTCCCTGGTTTTTCTGGCATCTCCCCTCGTGGCCATATGGGAACTGAAGAAAGATGTTTATGTCGTAGAATTGGATTGGTATCCGGATGCCCCTGGAGAAATGGTGGTCCTCACCTGTGACACCCCTGAAGAAGATGGTATCACCTGGACCTTGGACCAGAGCAGTGAGGTCTTAGGCTCTGGCAAAACCCTGACCATCCAAGTCAAAGAGTTTGGAGATGCTGGCCAGTACACCTGTCACAAAGGAGGCGAGGTTCTAAGCCATTCGCTCCTGCTGCTTCACAAAAAGGAAGATGGAATTTGGTCCACTGATATTTTAAAGGACCAGAAAGAACCCAAAAATAAGACCTTTCTAAGATGCGAGGCCAAGAATTATTCTGGACGTTTCACCTGCTGGTGGCTGACGACAATCAGTACTGATTTGACATTCAGTGTCAAAAGCAGCAGAGGCTCTTCTGACCCCCAAGGGGTGACGTGCGGAGCTGCTACACTCTCTGCAGAGAGAGTCAGAGGGGACAACAAGGAGTATGAGTACTCAGTGGAGTGCCAGGAGGACAGTGCCTGCCCAGCTGCTGAGGAGAGTCTGCCCATTGAGGTCATGGTGGATGCCGTTCACAAGCTCAAGTATGAAAACTACACCAGCAGCTTCTTCATCAGGGACATCATCAAACCTGACCCACCCAAGAACTTGCAGCTGAAGCCATTAAAGAATTCTCGGCAGGTGGAGGTCAGCTGGGAGTACCCTGACACCTGGAGTACTCCACATTCCTACTTCTCCCTGACATTCTGCGTTCAGGTCCAGGGCAAGAGCAAGAGAGAAAAGAAAGATAGAGTCTTCACGGACAAGACCTCAGCCACGGTCATCTGCCGCAAAAATGCCAGCATTAGCGTGCGGGCCCAGGACCGCTACTATAGCTCATCTTGGAGCGAATGGGCATCTGTGCCCTGCAGTTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-605 Pre-Made Ustekinumab biosimilar, Whole mAb, Anti-IL12B Antibody: Anti-CLMF/CLMF2/IL-12B/IMD28/IMD29/NKSF/NKSF2 therapeutic antibody
    Biosimilar GMP-Bios-ab-081 Pre-Made Briakinumab biosimilar, Whole mAb, Anti-IL12B Antibody: Anti-CLMF/CLMF2/IL-12B/IMD28/IMD29/NKSF/NKSF2 therapeutic antibody
    Biosimilar GMP-Bios-ab-162 Pre-Made Ebdarokimab biosimilar, Whole mAb, Anti-IL12B Antibody: Anti-CLMF/CLMF2/IL-12B/IMD28/IMD29/NKSF/NKSF2 therapeutic antibody
    Target Antibody GM-Tg-g-T95385-Ab Anti-IL12B/ CLMF/ CLMF2 functional antibody
    Target Antigen GM-Tg-g-T95385-Ag IL12B protein
    Cytokine cks-Tg-g-GM-T95385 Interleukin 12b (IL12B) protein & antibody
    ORF Viral Vector pGMLP000740 Human IL12B Lentivirus plasmid
    ORF Viral Vector pGMLP-IL-016 Human IL12B Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-099 Human IL12B Adenovirus plasmid
    ORF Viral Vector vGMLP000740 Human IL12B Lentivirus particle
    ORF Viral Vector vGMLP-IL-016 Human IL12B Lentivirus particle
    ORF Viral Vector vGMAP-IL-099 Human IL12B Adenovirus particle


    Target information

    Target ID GM-T95385
    Target Name IL12B
    Gene ID 3593, 16160, 694747, 64546, 768273, 403976, 281857, 100034222
    Gene Symbol and Synonyms CLMF,CLMF2,IL-12.p40,IL-12B,Il-12p40,Il12,IL12B,Il12p40,IMD28,IMD29,NKSF,NKSF2,p40
    Uniprot Accession P29460
    Uniprot Entry Name IL12B_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000113302
    Target Classification Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)

    This gene encodes a subunit of interleukin 12, a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. Interleukin 12 is a disulfide-linked heterodimer composed of the 40 kD cytokine receptor like subunit encoded by this gene, and a 35 kD subunit encoded by IL12A. This cytokine is expressed by activated macrophages that serve as an essential inducer of Th1 cells development. This cytokine has been found to be important for sustaining a sufficient number of memory/effector Th1 cells to mediate long-term protection to an intracellular pathogen. Overexpression of this gene was observed in the central nervous system of patients with multiple sclerosis (MS), suggesting a role of this cytokine in the pathogenesis of the disease. The promoter polymorphism of this gene has been reported to be associated with the severity of atopic and non-atopic asthma in children. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.