Human LIF/CDF/ DIA ORF/cDNA clone-Lentivirus particle (NM_002309)
Pre-made Human LIF/CDF/ DIA Lentiviral expression plasmid for LIF lentivirus packaging, LIF lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to LIF/CDF products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP000884 | Human LIF Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP000884 |
Gene Name | LIF |
Accession Number | NM_002309 |
Gene ID | 3976 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 609 bp |
Gene Alias | CDF, DIA, HILDA, MLPLI |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGGTCTTGGCGGCAGGAGTTGTGCCCCTGCTGTTGGTTCTGCACTGGAAACATGGGGCGGGGAGCCCCCTCCCCATCACCCCTGTCAACGCCACCTGTGCCATACGCCACCCATGTCACAACAACCTCATGAACCAGATCAGGAGCCAACTGGCACAGCTCAATGGCAGTGCCAATGCCCTCTTTATTCTCTATTACACAGCCCAGGGGGAGCCGTTCCCCAACAACCTGGACAAGCTATGTGGCCCCAACGTGACGGACTTCCCGCCCTTCCACGCCAACGGCACGGAGAAGGCCAAGCTGGTGGAGCTGTACCGCATAGTCGTGTACCTTGGCACCTCCCTGGGCAACATCACCCGGGACCAGAAGATCCTCAACCCCAGTGCCCTCAGCCTCCACAGCAAGCTCAACGCCACCGCCGACATCCTGCGAGGCCTCCTTAGCAACGTGCTGTGCCGCCTGTGCAGCAAGTACCACGTGGGCCATGTGGACGTGACCTACGGCCCTGACACCTCGGGTAAGGATGTCTTCCAGAAGAAGAAGCTGGGCTGTCAACTCCTGGGGAAGTATAAGCAGATCATCGCCGTGTTGGCCCAGGCCTTCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T29774-Ab | Anti-LIF/ CDF/ DIA functional antibody |
Target Antigen | GM-Tg-g-T29774-Ag | LIF protein |
Cytokine | cks-Tg-g-GM-T29774 | leukemia inhibitory factor (LIF) protein & antibody |
ORF Viral Vector | pGMLP000884 | Human LIF Lentivirus plasmid |
ORF Viral Vector | vGMLP000884 | Human LIF Lentivirus particle |
Target information
Target ID | GM-T29774 |
Target Name | LIF |
Gene ID | 3976, 16878, 715456, 60584, 101090296, 403449, 280840, 100629131 |
Gene Symbol and Synonyms | CDF,DIA,HILDA,LIF,MLPLI |
Uniprot Accession | P15018 |
Uniprot Entry Name | LIF_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000128342 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene is a pleiotropic cytokine with roles in several different systems. It is involved in the induction of hematopoietic differentiation in normal and myeloid leukemia cells, induction of neuronal cell differentiation, regulator of mesenchymal to epithelial conversion during kidney development, and may also have a role in immune tolerance at the maternal-fetal interface. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.