Human HSD17B1/17-beta-HSD/20-alpha-HSD ORF/cDNA clone-Lentivirus particle (NM_001330219.2)

Cat. No.: vGMLP000906

Pre-made Human HSD17B1/17-beta-HSD/20-alpha-HSD Lentiviral expression plasmid for HSD17B1 lentivirus packaging, HSD17B1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to 17-beta-HSD1/HSD17B1/17-beta-HSD products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000906 Human HSD17B1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000906
Gene Name HSD17B1
Accession Number NM_001330219.2
Gene ID 3292
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 990 bp
Gene Alias 17-beta-HSD,20-alpha-HSD,E2DH,EDH17B2,EDHB17,HSD17,SDR28C1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCCGCACCGTGGTGCTCATCACCGGCTGTTCCTCGGGCATCGGCCTGCACTTGGCCGTACGTCTGGCTTCAGATCCATCCCAGAGCTTCAAAGTGTATGCCACGTTGAGGGACCTGAAAACACAGGGCCGGCTGTGGGAGGCGGCCCGGGCCCTGGCATGCCCTCCGGGATCCCTGGAGACGTTGCAGCTGGACGTAAGGGACTCAAAATCCGTGGCCGCTGCCCGGGAACGCGTGACTGAGGGCCGCGTGGACGTGCTGGTGTGTAACGCAGGCCTGGGCCTGCTGGGGCCGCTGGAGGCGCTGGGGGAGGACGCCGTGGCCTCTGTGCTGGACGTGAATGTAGTAGGGACTGTGCGGATGCTGCAGGCCTTCCTGCCAGACATGAAGAGGCGCGGTTCGGGACGCGTGTTGGTGACCGGGAGCGTGGGAGGATTGATGGGGCTGCCTTTCAATGACGTTTATTGCGCCAGCAAGTTCGCGCTCGAAGGCTTATGCGAGAGTCTGGCGGTTCTGCTGCTGCCCTTTGGGGTCCACAGCTTGAGCCTGATCGAGTGCGGCCCAGTGCACACCGCCTTCATGGAGAAGGTGTTGGGCAGCCCAGAGGAGGTGCTGGACCGCACGGACATCCACACCTTCCACCGCTTCTACCAATACCTCGCCCACAGCAAGCAAGTCTTTCGCGAGGCGGCGCAGAACCCTGAGGAGGTGGCGGAGGTCTTCCTCACCGCTTTGCGCGCCCCGAAGCCGACCCTGCGCTACTTCACCACCGAGCGCTTCCTGCCCCTGCTGCGGATGCGCCTGGACGACCCCAGCGGCTCCAACTACGTCACCGCCATGCACCGGGAAGTGTTCGGCGACGTTCCGGCAAAGGCCGAGGCTGGGGCCGAGGCTGGGGGCGGGGCCGGGCCTGGGGCAGAGGACGAGGCCGGGCGCGGTGCGGTGGGGGACCCTGAGCTCGGCGATCCTCCGGCCGCCCCGCAGTAA
ORF Protein Sequence MARTVVLITGCSSGIGLHLAVRLASDPSQSFKVYATLRDLKTQGRLWEAARALACPPGSLETLQLDVRDSKSVAAARERVTEGRVDVLVCNAGLGLLGPLEALGEDAVASVLDVNVVGTVRMLQAFLPDMKRRGSGRVLVTGSVGGLMGLPFNDVYCASKFALEGLCESLAVLLLPFGVHSLSLIECGPVHTAFMEKVLGSPEEVLDRTDIHTFHRFYQYLAHSKQVFREAAQNPEEVAEVFLTALRAPKPTLRYFTTERFLPLLRMRLDDPSGSNYVTAMHREVFGDVPAKAEAGAEAGGGAGPGAEDEAGRGAVGDPELGDPPAAPQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T44011-Ab Anti-17-beta-HSD1 monoclonal antibody
    Target Antigen GM-Tg-g-T44011-Ag 17-beta-HSD1/HSD17B1 protein
    ORF Viral Vector pGMLP000906 Human HSD17B1 Lentivirus plasmid
    ORF Viral Vector vGMLP000906 Human HSD17B1 Lentivirus particle


    Target information

    Target ID GM-T44011
    Target Name 17-beta-HSD1
    Gene ID 3292, 15485, 710392, 25322, 101091417, 607570, 353107, 100036556
    Gene Symbol and Synonyms 17-beta-HSD,17beta-HSD,17BHD1,17HSDB1,20-alpha-HSD,E2DH,EDH17B2,EDHB17,HSD17,HSD17B1,Hsd17ba,SDR28C1
    Uniprot Accession P14061
    Uniprot Entry Name DHB1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000108786
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of the 17beta-hydroxysteroid dehydrogenase family of short-chain dehydrogenases/reductases. It has a dual function in estrogen activation and androgen inactivation and plays a major role in establishing the estrogen E2 concentration gradient between serum and peripheral tissues. The encoded protein catalyzes the last step in estrogen activation, using NADPH to convert estrogens E1 and E2 and androgens like 4-androstenedione, to testosterone. It has an N-terminal short-chain dehydrogenase domain with a cofactor binding site, and a narrow, hydrophobic C-terminal domain with a steroid substrate binding site. This gene is expressed primarily in the placenta and ovarian granulosa cells, and to a lesser extent, in the endometrium, adipose tissue, and prostate. Polymorphisms in this gene have been linked to breast and prostate cancer. A pseudogene of this gene has been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.