Human CCR10/GPR2 ORF/cDNA clone-Lentivirus particle (NM_016602)
Pre-made Human CCR10/GPR2 Lentiviral expression plasmid for CCR10 lentivirus packaging, CCR10 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CCR10/GPR2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001466 | Human CCR10 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001466 |
Gene Name | CCR10 |
Accession Number | NM_016602 |
Gene ID | 2826 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1089 bp |
Gene Alias | GPR2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGGACGGAGGCCACAGAGCAGGTTTCCTGGGGCCATTACTCTGGGGATGAAGAGGACGCATACTCGGCTGAGCCACTGCCGGAGCTTTGCTACAAGGCCGATGTCCAGGCCTTCAGCCGGGCCTTCCAACCCAGTGTCTCCCTGACCGTGGCTGCGCTGGGTCTGGCCGGCAATGGCCTGGTCCTGGCCACCCACCTGGCAGCCCGACGCGCAGCGCGCTCGCCCACCTCTGCCCACCTGCTCCAGCTGGCCCTGGCCGACCTCTTGCTGGCCCTGACTCTGCCCTTCGCGGCAGCAGGGGCTCTTCAGGGCTGGAGTCTGGGAAGTGCCACCTGCCGCACCATCTCTGGCCTCTACTCGGCCTCCTTCCACGCCGGCTTCCTCTTCCTGGCCTGTATCAGCGCCGACCGCTACGTGGCCATCGCGCGAGCGCTCCCAGCCGGGCCGCGGCCCTCCACTCCCGGCCGCGCACACTTGGTCTCCGTCATCGTGTGGCTGCTGTCACTGCTCCTGGCGCTGCCTGCGCTGCTCTTCAGCCAGGATGGGCAGCGGGAAGGCCAACGACGCTGTCGCCTCATCTTCCCCGAGGGCCTCACGCAGACGGTGAAGGGGGCGAGCGCCGTGGCGCAGGTGGCCCTGGGCTTCGCGCTGCCGCTGGGCGTCATGGTAGCCTGCTACGCGCTTCTGGGCCGCACGCTGCTGGCCGCCAGGGGGCCCGAGCGCCGGCGTGCGCTGCGCGTCGTGGTGGCTCTGGTGGCGGCCTTCGTGGTGCTGCAGCTGCCCTACAGCCTCGCCCTGCTGCTGGATACTGCCGATCTACTGGCTGCGCGCGAGCGGAGCTGCCCTGCCAGCAAACGCAAGGATGTCGCACTGCTGGTGACCAGCGGCTTGGCCCTCGCCCGCTGTGGCCTCAATCCCGTTCTCTACGCCTTCCTGGGCCTGCGCTTCCGCCAGGACCTGCGGAGGCTGCTACGGGGTGGGAGCTGCCCCTCAGGGCCTCAACCCCGCCGCGGCTGCCCCCGCCGGCCCCGCCTTTCTTCCTGCTCAGCTCCCACGGAGACCCACAGTCTCTCCTGGGACAACTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0189-Ab | Anti-CCR10/ GPR2 monoclonal antibody |
Target Antigen | GM-Tg-g-MP0189-Ag | CCR10 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-MP0189 | chemokine (C-C motif) receptor 10 (CCR10) protein & antibody |
ORF Viral Vector | pGMLP001466 | Human CCR10 Lentivirus plasmid |
ORF Viral Vector | vGMLP001466 | Human CCR10 Lentivirus particle |
Target information
Target ID | GM-MP0189 |
Target Name | CCR10 |
Gene ID | 2826, 12777, 711255, 363682, 101092409, 607528, 539108, 100065946 |
Gene Symbol and Synonyms | C-C CKR-10,CC-CKR-10,CCR-10,CCR10,Cmkbr9,GPR2 |
Uniprot Accession | P46092 |
Uniprot Entry Name | CCR10_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000184451 |
Target Classification | Not Available |
Chemokines are a group of small (approximately 8 to 14 kD), mostly basic, structurally related molecules that regulate cell trafficking of various types of leukocytes through interactions with a subset of 7-transmembrane, G protein-coupled receptors. Chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. Chemokines are divided into 2 major subfamilies, CXC and CC, based on the arrangement of the first 2 of the 4 conserved cysteine residues; the 2 cysteines are separated by a single amino acid in CXC chemokines and are adjacent in CC chemokines. CCR10 is the receptor for CCL27 (SCYA27; MIM 604833); CCR10-CCL27 interactions are involved in T cell-mediated skin inflammation (Homey et al., 2002 [PubMed 11821900]).[supplied by OMIM, Mar 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.