Human OPRK1/K-OR-1/ KOR ORF/cDNA clone-Lentivirus particle (NM_000912)
Pre-made Human OPRK1/K-OR-1/ KOR Lentiviral expression plasmid for OPRK1 lentivirus packaging, OPRK1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to OPRK1/K-OR-1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001541 | Human OPRK1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001541 |
Gene Name | OPRK1 |
Accession Number | NM_000912 |
Gene ID | 4986 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1143 bp |
Gene Alias | K-OR-1, KOR, KOR-1, OPRK |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGACTCCCCGATCCAGATCTTCCGCGGGGAGCCGGGCCCTACCTGCGCCCCGAGCGCCTGCCTGCCCCCCAACAGCAGCGCCTGGTTTCCCGGCTGGGCCGAGCCCGACAGCAACGGCAGCGCCGGCTCGGAGGACGCGCAGCTGGAGCCCGCGCACATCTCCCCGGCCATCCCGGTCATCATCACGGCGGTCTACTCCGTAGTGTTCGTCGTGGGCTTGGTGGGCAACTCGCTGGTCATGTTCGTGATCATCCGATACACAAAGATGAAGACAGCAACCAACATTTACATATTTAACCTGGCTTTGGCAGATGCTTTAGTTACTACAACCATGCCCTTTCAGAGTACGGTCTACTTGATGAATTCCTGGCCTTTTGGGGATGTGCTGTGCAAGATAGTAATTTCCATTGATTACTACAACATGTTCACCAGCATCTTCACCTTGACCATGATGAGCGTGGACCGCTACATTGCCGTGTGCCACCCCGTGAAGGCTTTGGACTTCCGCACACCCTTGAAGGCAAAGATCATCAATATCTGCATCTGGCTGCTGTCGTCATCTGTTGGCATCTCTGCAATAGTCCTTGGAGGCACCAAAGTCAGGGAAGACGTCGATGTCATTGAGTGCTCCTTGCAGTTCCCAGATGATGACTACTCCTGGTGGGACCTCTTCATGAAGATCTGCGTCTTCATCTTTGCCTTCGTGATCCCTGTCCTCATCATCATCGTCTGCTACACCCTGATGATCCTGCGTCTCAAGAGCGTCCGGCTCCTTTCTGGCTCCCGAGAGAAAGATCGCAACCTGCGTAGGATCACCAGACTGGTCCTGGTGGTGGTGGCAGTCTTCGTCGTCTGCTGGACTCCCATTCACATATTCATCCTGGTGGAGGCTCTGGGGAGCACCTCCCACAGCACAGCTGCTCTCTCCAGCTATTACTTCTGCATCGCCTTAGGCTATACCAACAGTAGCCTGAATCCCATTCTCTACGCCTTTCTTGATGAAAACTTCAAGCGGTGTTTCCGGGACTTCTGCTTTCCACTGAAGATGAGGATGGAGCGGCAGAGCACTAGCAGAGTCCGAAATACAGTTCAGGATCCTGCTTACCTGAGGGACATCGATGGGATGAATAAACCAGTATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T60693-Ab | Anti-OPRK/ OPRK1/ K-OR-1 monoclonal antibody |
Target Antigen | GM-Tg-g-T60693-Ag | OPRK1 VLP (virus-like particle) |
ORF Viral Vector | pGMLP001541 | Human OPRK1 Lentivirus plasmid |
ORF Viral Vector | vGMLP001541 | Human OPRK1 Lentivirus particle |
Target information
Target ID | GM-T60693 |
Target Name | OPRK1 |
Gene ID | 4986, 18387, 710783, 29335, 101094729, 486951, 540519, 100054492 |
Gene Symbol and Synonyms | K-OR-1,KOP,KOR,KOR-1,KOR1,MSL-1,OPRK,OPRK1,Oprk2,R21 |
Uniprot Accession | P41145 |
Uniprot Entry Name | OPRK_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000082556 |
Target Classification | GPCR |
This gene encodes an opioid receptor, which is a member of the 7 transmembrane-spanning G protein-coupled receptor family. It functions as a receptor for endogenous ligands, as well as a receptor for various synthetic opioids. Ligand binding results in inhibition of adenylate cyclase activity and neurotransmitter release. This opioid receptor plays a role in the perception of pain and mediating the hypolocomotor, analgesic and aversive actions of synthetic opioids. Variations in this gene have also been associated with alcohol dependence and opiate addiction. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study provided evidence for translational readthrough in this gene, and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.