Human OPRK1/K-OR-1/KOR ORF/cDNA clone-Lentivirus particle (NM_000912)

Cat. No.: vGMLP001541

Pre-made Human OPRK1/K-OR-1/KOR Lentiviral expression plasmid for OPRK1 lentivirus packaging, OPRK1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to OPRK1/K-OR-1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001541 Human OPRK1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001541
Gene Name OPRK1
Accession Number NM_000912
Gene ID 4986
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1143 bp
Gene Alias K-OR-1,KOR,KOR-1,OPRK
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGACTCCCCGATCCAGATCTTCCGCGGGGAGCCGGGCCCTACCTGCGCCCCGAGCGCCTGCCTGCCCCCCAACAGCAGCGCCTGGTTTCCCGGCTGGGCCGAGCCCGACAGCAACGGCAGCGCCGGCTCGGAGGACGCGCAGCTGGAGCCCGCGCACATCTCCCCGGCCATCCCGGTCATCATCACGGCGGTCTACTCCGTAGTGTTCGTCGTGGGCTTGGTGGGCAACTCGCTGGTCATGTTCGTGATCATCCGATACACAAAGATGAAGACAGCAACCAACATTTACATATTTAACCTGGCTTTGGCAGATGCTTTAGTTACTACAACCATGCCCTTTCAGAGTACGGTCTACTTGATGAATTCCTGGCCTTTTGGGGATGTGCTGTGCAAGATAGTAATTTCCATTGATTACTACAACATGTTCACCAGCATCTTCACCTTGACCATGATGAGCGTGGACCGCTACATTGCCGTGTGCCACCCCGTGAAGGCTTTGGACTTCCGCACACCCTTGAAGGCAAAGATCATCAATATCTGCATCTGGCTGCTGTCGTCATCTGTTGGCATCTCTGCAATAGTCCTTGGAGGCACCAAAGTCAGGGAAGACGTCGATGTCATTGAGTGCTCCTTGCAGTTCCCAGATGATGACTACTCCTGGTGGGACCTCTTCATGAAGATCTGCGTCTTCATCTTTGCCTTCGTGATCCCTGTCCTCATCATCATCGTCTGCTACACCCTGATGATCCTGCGTCTCAAGAGCGTCCGGCTCCTTTCTGGCTCCCGAGAGAAAGATCGCAACCTGCGTAGGATCACCAGACTGGTCCTGGTGGTGGTGGCAGTCTTCGTCGTCTGCTGGACTCCCATTCACATATTCATCCTGGTGGAGGCTCTGGGGAGCACCTCCCACAGCACAGCTGCTCTCTCCAGCTATTACTTCTGCATCGCCTTAGGCTATACCAACAGTAGCCTGAATCCCATTCTCTACGCCTTTCTTGATGAAAACTTCAAGCGGTGTTTCCGGGACTTCTGCTTTCCACTGAAGATGAGGATGGAGCGGCAGAGCACTAGCAGAGTCCGAAATACAGTTCAGGATCCTGCTTACCTGAGGGACATCGATGGGATGAATAAACCAGTATGA
ORF Protein Sequence MDSPIQIFRGEPGPTCAPSACLPPNSSAWFPGWAEPDSNGSAGSEDAQLEPAHISPAIPVIITAVYSVVFVVGLVGNSLVMFVIIRYTKMKTATNIYIFNLALADALVTTTMPFQSTVYLMNSWPFGDVLCKIVISIDYYNMFTSIFTLTMMSVDRYIAVCHPVKALDFRTPLKAKIINICIWLLSSSVGISAIVLGGTKVREDVDVIECSLQFPDDDYSWWDLFMKICVFIFAFVIPVLIIIVCYTLMILRLKSVRLLSGSREKDRNLRRITRLVLVVVAVFVVCWTPIHIFILVEALGSTSHSTAALSSYYFCIALGYTNSSLNPILYAFLDENFKRCFRDFCFPLKMRMERQSTSRVRNTVQDPAYLRDIDGMNKPV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T60693-Ab Anti-OPRK/ OPRK1/ K-OR-1 monoclonal antibody
    Target Antigen GM-Tg-g-T60693-Ag OPRK1 VLP (virus-like particle)
    ORF Viral Vector pGMLP001541 Human OPRK1 Lentivirus plasmid
    ORF Viral Vector vGMLP001541 Human OPRK1 Lentivirus particle


    Target information

    Target ID GM-T60693
    Target Name OPRK1
    Gene ID 4986, 18387, 710783, 29335, 101094729, 486951, 540519, 100054492
    Gene Symbol and Synonyms K-OR-1,KOP,KOR,KOR-1,KOR1,MSL-1,OPRK,OPRK1,Oprk2,R21
    Uniprot Accession P41145
    Uniprot Entry Name OPRK_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000082556
    Target Classification GPCR

    This gene encodes an opioid receptor, which is a member of the 7 transmembrane-spanning G protein-coupled receptor family. It functions as a receptor for endogenous ligands, as well as a receptor for various synthetic opioids. Ligand binding results in inhibition of adenylate cyclase activity and neurotransmitter release. This opioid receptor plays a role in the perception of pain and mediating the hypolocomotor, analgesic and aversive actions of synthetic opioids. Variations in this gene have also been associated with alcohol dependence and opiate addiction. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study provided evidence for translational readthrough in this gene, and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2017]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.