Human AVPR1B/AVPR3/ V1bR ORF/cDNA clone-Lentivirus particle (NM_000707)

Pre-made Human AVPR1B/AVPR3/ V1bR Lentiviral expression plasmid for AVPR1B lentivirus packaging, AVPR1B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to V1BR/AVPR1B/AVPR3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001606 Human AVPR1B Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001606
Gene Name AVPR1B
Accession Number NM_000707
Gene ID 553
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1275 bp
Gene Alias AVPR3, V1bR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGATTCTGGGCCTCTGTGGGATGCCAACCCCACCCCTCGGGGCACCCTCTCTGCCCCCAATGCCACAACACCCTGGCTGGGCCGGGATGAGGAGCTGGCCAAGGTGGAGATCGGAGTCCTGGCCACTGTCCTGGTGCTGGCGACCGGGGGCAACCTGGCTGTGCTGCTGACCCTGGGCCAGCTGGGCCGCAAGCGCTCCCGCATGCACCTGTTCGTGCTGCACTTAGCCCTGACAGACCTGGCCGTGGCGCTCTTCCAGGTGCTGCCACAGCTGCTGTGGGACATCACCTACCGCTTCCAGGGCCCCGACCTCCTGTGCAGGGCCGTCAAGTACCTGCAGGTGCTCAGCATGTTTGCCTCCACCTACATGCTGCTGGCCATGACGCTGGACCGCTACCTGGCTGTCTGTCACCCCCTGCGCAGCCTCCAGCAGCCAGGCCAGTCCACCTACCTGCTCATCGCTGCTCCCTGGCTGCTGGCCGCCATCTTCAGCCTCCCTCAAGTCTTCATTTTTTCCCTGCGGGAGGTGATCCAGGGCTCAGGGGTGCTGGACTGCTGGGCAGACTTCGGCTTCCCTTGGGGGCCACGGGCCTACCTCACCTGGACCACCCTGGCTATCTTCGTTCTGCCGGTGACCATGCTCACGGCCTGCTACAGCCTCATCTGCCATGAGATCTGTAAAAACCTAAAAGTCAAGACACAGGCCTGGCGGGTGGGAGGAGGGGGCTGGAGGACTTGGGACAGGCCCTCACCTTCCACCTTAGCTGCCACCACTCGGGGGCTGCCATCTCGGGTCAGCAGCATCAACACCATCTCACGGGCCAAGATCCGAACAGTGAAGATGACCTTTGTCATCGTGCTGGCCTACATCGCTTGCTGGGCTCCCTTCTTCAGTGTCCAGATGTGGTCCGTGTGGGACAAGAATGCCCCTGATGAAGATTCCACCAATGTGGCTTTCACCATCTCTATGCTTTTGGGCAACCTCAACAGCTGCTGCAACCCCTGGATCTACATGGGCTTCAACAGCCACCTGTTACCGCGGCCCCTGCGTCACCTTGCCTGCTGTGGGGGTCCCCAGCCCAGGATGCGCCGGCGGCTCTCCGACGGCAGCCTCTCGAGCCGCCACACCACGCTGCTGACCCGCTCCAGCTGCCCGGCCACCCTCAGCCTCAGCCTCAGCCTAACCCTCAGTGGGAGGCCCAGGCCTGAAGAGTCACCAAGGGACTTGGAGCTGGCAGATGGGGAAGGCACCGCTGAGACCATCATCTTTTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T59881-Ab Anti-V1BR/ AVPR1B/ AVPR3 monoclonal antibody
    Target Antigen GM-Tg-g-T59881-Ag V1BR/AVPR1B VLP (virus-like particle)
    ORF Viral Vector pGMLP001606 Human AVPR1B Lentivirus plasmid
    ORF Viral Vector vGMLP001606 Human AVPR1B Lentivirus particle


    Target information

    Target ID GM-T59881
    Target Name V1BR
    Gene ID 553, 26361, 695963, 100909648, 101088713, 488578, 282861, 100055260
    Gene Symbol and Synonyms AVPR V1b,AVPR V3,AVPR1B,AVPR3,V1bR,V3/V1b,VIBR,VPR3
    Uniprot Accession P47901
    Uniprot Entry Name V1BR_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000198049
    Target Classification Not Available

    The protein encoded by this gene acts as receptor for arginine vasopressin. This receptor belongs to the subfamily of G-protein coupled receptors which includes AVPR1A, V2R and OXT receptors. Its activity is mediated by G proteins which stimulate a phosphatidylinositol-calcium second messenger system. The receptor is primarily located in the anterior pituitary, where it stimulates ACTH release. It is expressed at high levels in ACTH-secreting pituitary adenomas as well as in bronchial carcinoids responsible for the ectopic ACTH syndrome. A spliced antisense transcript of this gene has been reported but its function is not known. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.