Human AVPR1B/AVPR3/ V1bR ORF/cDNA clone-Lentivirus particle (NM_000707)
Pre-made Human AVPR1B/AVPR3/ V1bR Lentiviral expression plasmid for AVPR1B lentivirus packaging, AVPR1B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to V1BR/AVPR1B/AVPR3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001606 | Human AVPR1B Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001606 |
Gene Name | AVPR1B |
Accession Number | NM_000707 |
Gene ID | 553 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1275 bp |
Gene Alias | AVPR3, V1bR |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGATTCTGGGCCTCTGTGGGATGCCAACCCCACCCCTCGGGGCACCCTCTCTGCCCCCAATGCCACAACACCCTGGCTGGGCCGGGATGAGGAGCTGGCCAAGGTGGAGATCGGAGTCCTGGCCACTGTCCTGGTGCTGGCGACCGGGGGCAACCTGGCTGTGCTGCTGACCCTGGGCCAGCTGGGCCGCAAGCGCTCCCGCATGCACCTGTTCGTGCTGCACTTAGCCCTGACAGACCTGGCCGTGGCGCTCTTCCAGGTGCTGCCACAGCTGCTGTGGGACATCACCTACCGCTTCCAGGGCCCCGACCTCCTGTGCAGGGCCGTCAAGTACCTGCAGGTGCTCAGCATGTTTGCCTCCACCTACATGCTGCTGGCCATGACGCTGGACCGCTACCTGGCTGTCTGTCACCCCCTGCGCAGCCTCCAGCAGCCAGGCCAGTCCACCTACCTGCTCATCGCTGCTCCCTGGCTGCTGGCCGCCATCTTCAGCCTCCCTCAAGTCTTCATTTTTTCCCTGCGGGAGGTGATCCAGGGCTCAGGGGTGCTGGACTGCTGGGCAGACTTCGGCTTCCCTTGGGGGCCACGGGCCTACCTCACCTGGACCACCCTGGCTATCTTCGTTCTGCCGGTGACCATGCTCACGGCCTGCTACAGCCTCATCTGCCATGAGATCTGTAAAAACCTAAAAGTCAAGACACAGGCCTGGCGGGTGGGAGGAGGGGGCTGGAGGACTTGGGACAGGCCCTCACCTTCCACCTTAGCTGCCACCACTCGGGGGCTGCCATCTCGGGTCAGCAGCATCAACACCATCTCACGGGCCAAGATCCGAACAGTGAAGATGACCTTTGTCATCGTGCTGGCCTACATCGCTTGCTGGGCTCCCTTCTTCAGTGTCCAGATGTGGTCCGTGTGGGACAAGAATGCCCCTGATGAAGATTCCACCAATGTGGCTTTCACCATCTCTATGCTTTTGGGCAACCTCAACAGCTGCTGCAACCCCTGGATCTACATGGGCTTCAACAGCCACCTGTTACCGCGGCCCCTGCGTCACCTTGCCTGCTGTGGGGGTCCCCAGCCCAGGATGCGCCGGCGGCTCTCCGACGGCAGCCTCTCGAGCCGCCACACCACGCTGCTGACCCGCTCCAGCTGCCCGGCCACCCTCAGCCTCAGCCTCAGCCTAACCCTCAGTGGGAGGCCCAGGCCTGAAGAGTCACCAAGGGACTTGGAGCTGGCAGATGGGGAAGGCACCGCTGAGACCATCATCTTTTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T59881-Ab | Anti-V1BR/ AVPR1B/ AVPR3 monoclonal antibody |
Target Antigen | GM-Tg-g-T59881-Ag | V1BR/AVPR1B VLP (virus-like particle) |
ORF Viral Vector | pGMLP001606 | Human AVPR1B Lentivirus plasmid |
ORF Viral Vector | vGMLP001606 | Human AVPR1B Lentivirus particle |
Target information
Target ID | GM-T59881 |
Target Name | V1BR |
Gene ID | 553, 26361, 695963, 100909648, 101088713, 488578, 282861, 100055260 |
Gene Symbol and Synonyms | AVPR V1b,AVPR V3,AVPR1B,AVPR3,V1bR,V3/V1b,VIBR,VPR3 |
Uniprot Accession | P47901 |
Uniprot Entry Name | V1BR_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000198049 |
Target Classification | Not Available |
The protein encoded by this gene acts as receptor for arginine vasopressin. This receptor belongs to the subfamily of G-protein coupled receptors which includes AVPR1A, V2R and OXT receptors. Its activity is mediated by G proteins which stimulate a phosphatidylinositol-calcium second messenger system. The receptor is primarily located in the anterior pituitary, where it stimulates ACTH release. It is expressed at high levels in ACTH-secreting pituitary adenomas as well as in bronchial carcinoids responsible for the ectopic ACTH syndrome. A spliced antisense transcript of this gene has been reported but its function is not known. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.