Human IL5RA/CD125/ CDw125 ORF/cDNA clone-Lentivirus particle (NM_175725)
Pre-made Human IL5RA/CD125/ CDw125 Lentiviral expression plasmid for IL5RA lentivirus packaging, IL5RA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to IL5RA/CD125 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001668 | Human IL5RA Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001668 |
Gene Name | IL5RA |
Accession Number | NM_175725 |
Gene ID | 3568 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1008 bp |
Gene Alias | CD125, CDw125, HSIL5R3, IL5R |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGATCATCGTGGCGCATGTATTACTCATCCTTTTGGGGGCCACTGAGATACTGCAAGCTGACTTACTTCCTGATGAAAAGATTTCACTTCTCCCACCTGTCAATTTCACCATTAAAGTTACTGGTTTGGCTCAAGTTCTTTTACAATGGAAACCAAATCCTGATCAAGAGCAAAGGAATGTTAATCTAGAATATCAAGTGAAAATAAACGCTCCAAAAGAAGATGACTATGAAACCAGAATCACTGAAAGCAAATGTGTAACCATCCTCCACAAAGGCTTTTCAGCAAGTGTGCGGACCATCCTGCAGAACGACCACTCACTACTGGCCAGCAGCTGGGCTTCTGCTGAACTTCATGCCCCACCAGGGTCTCCTGGAACCTCAATTGTGAATTTAACTTGCACCACAAACACTACAGAAGACAATTATTCACGTTTAAGGTCATACCAAGTTTCCCTTCACTGCACCTGGCTTGTTGGCACAGATGCCCCTGAGGACACGCAGTATTTTCTCTACTATAGGTATGGCTCTTGGACTGAAGAATGCCAAGAATACAGCAAAGACACACTGGGGAGAAATATCGCATGCTGGTTTCCCAGGACTTTTATCCTCAGCAAAGGGCGTGACTGGCTTGCGGTGCTTGTTAACGGCTCCAGCAAGCACTCTGCTATCAGGCCCTTTGATCAGCTGTTTGCCCTTCACGCCATTGATCAAATAAATCCTCCACTGAATGTCACAGCAGAGATTGAAGGAACTCGTCTCTCTATCCAATGGGAGAAACCAGTGTCTGCTTTTCCAATCCATTGCTTTGATTATGAAGTAAAAATACACAATACAAGGAATGGATATTTGCAGATAGAAAAATTGATGACCAATGCATTCATCTCAATAATTGATGATCTTTCTAAGTACGATGTTCAAGTGAGAGCAGCAGTGAGCTCCATGTGCAGAGAGGCAGGGCTCTGGAGTGAGTGGAGCCAACCTATTTATGTGGGGTTCTCAAGATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-058 | Pre-Made Benralizumab biosimilar, Whole mAb, Anti-IL5RA Antibody: Anti-CD125/CDw125/HSIL5R3/IL5R therapeutic antibody |
Target Antibody | GM-Tg-g-T90828-Ab | Anti-IL5RA/ CD125/ CDw125 monoclonal antibody |
Target Antigen | GM-Tg-g-T90828-Ag | IL5RA VLP (virus-like particle) |
ORF Viral Vector | pGMLP001668 | Human IL5RA Lentivirus plasmid |
ORF Viral Vector | vGMLP001668 | Human IL5RA Lentivirus particle |
Target information
Target ID | GM-T90828 |
Target Name | IL5RA |
Gene ID | 3568, 16192, 704649, 114103, 101099031, 476553, 615848, 100060212 |
Gene Symbol and Synonyms | CD125,CDw125,HSIL5R3,IL5R,IL5RA |
Uniprot Accession | Q01344 |
Uniprot Entry Name | IL5RA_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, INN Index |
Disease | Not Available |
Gene Ensembl | ENSG00000091181 |
Target Classification | Not Available |
The protein encoded by this gene is an interleukin 5 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL5 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL5. This protein has been found to interact with syndecan binding protein (syntenin), which is required for IL5 mediated activation of the transcription factor SOX4. Several alternatively spliced transcript variants encoding four distinct isoforms have been reported. [provided by RefSeq, Jul 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.