Human SCN4B/ATFB17/LQT10 ORF/cDNA clone-Lentivirus particle (NM_174934)

Cat. No.: vGMLP001845

Pre-made Human SCN4B/ATFB17/LQT10 Lentiviral expression plasmid for SCN4B lentivirus packaging, SCN4B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to SCN4B/ATFB17 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001845 Human SCN4B Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001845
Gene Name SCN4B
Accession Number NM_174934
Gene ID 6330
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 687 bp
Gene Alias ATFB17,LQT10,Navbeta4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCCGGGGCTGGGGACGGAGGCAAAGCCCCGGCGAGATGGCTGGGCACTGGGCTTTTGGGCCTCTTCCTGCTCCCCGTAACCCTGTCGCTGGAGGTGTCTGTGGGAAAGGCCACCGACATCTACGCTGTCAATGGCACGGAGATCCTGCTGCCCTGCACCTTCTCCAGCTGCTTTGGCTTCGAGGACCTCCACTTCCGGTGGACCTACAACAGCAGTGACGCATTCAAGATTCTCATAGAGGGGACTGTGAAGAATGAGAAGTCTGACCCCAAGGTGACGTTGAAAGACGATGACCGCATCACTCTGGTAGGCTCTACTAAGGAGAAGATGAACAACATTTCCATTGTGCTGAGGGACCTGGAGTTCAGCGACACGGGCAAATACACCTGCCATGTGAAGAACCCCAAGGAGAATAATCTCCAGCACCACGCCACCATCTTCCTCCAAGTCGTTGATAGACTGGAAGAAGTGGACAACACAGTGACACTCATCATCCTGGCTGTCGTGGGCGGGGTCATCGGGCTCCTCATCCTCATCCTGCTGATCAAGAAACTCATCATCTTCATCCTGAAGAAGACTCGGGAGAAGAAGAAGGAGTGTCTCGTGAGCTCCTCGGGGAATGACAACACGGAGAACGGCTTGCCTGGCTCCAAGGCAGAGGAGAAACCACCTTCAAAAGTGTGA
ORF Protein Sequence MPGAGDGGKAPARWLGTGLLGLFLLPVTLSLEVSVGKATDIYAVNGTEILLPCTFSSCFGFEDLHFRWTYNSSDAFKILIEGTVKNEKSDPKVTLKDDDRITLVGSTKEKMNNISIVLRDLEFSDTGKYTCHVKNPKENNLQHHATIFLQVVDRLEEVDNTVTLIILAVVGGVIGLLILILLIKKLIIFILKKTREKKKECLVSSSGNDNTENGLPGSKAEEKPPSKV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1490-Ab Anti-SCN4B/ ATFB17/ LQT10 monoclonal antibody
    Target Antigen GM-Tg-g-MP1490-Ag SCN4B VLP (virus-like particle)
    ORF Viral Vector pGMLP001845 Human SCN4B Lentivirus plasmid
    ORF Viral Vector vGMLP001845 Human SCN4B Lentivirus particle


    Target information

    Target ID GM-MP1490
    Target Name SCN4B
    Gene ID 6330, 399548, 100430940, 315611, 101087863, 100688178, 538100, 100071197
    Gene Symbol and Synonyms ATFB17,Gm1471,LQT10,Navbeta4,SCN4B
    Uniprot Accession Q8IWT1
    Uniprot Entry Name SCN4B_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000177098
    Target Classification Not Available

    The protein encoded by this gene is one of several sodium channel beta subunits. These subunits interact with voltage-gated alpha subunits to change sodium channel kinetics. The encoded transmembrane protein forms interchain disulfide bonds with SCN2A. Defects in this gene are a cause of long QT syndrome type 10 (LQT10). Three protein-coding and one non-coding transcript variant have been found for this gene.[provided by RefSeq, Mar 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.