Human KLF9/BTEB/BTEB1 ORF/cDNA clone-Lentivirus particle (NM_001206.2)

Cat. No.: vGMLP001959

Pre-made Human KLF9/BTEB/BTEB1 Lentiviral expression plasmid for KLF9 lentivirus packaging, KLF9 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to KLF9/BTEB products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001959 Human KLF9 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001959
Gene Name KLF9
Accession Number NM_001206.2
Gene ID 687
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 735 bp
Gene Alias BTEB,BTEB1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCCGCGGCCGCCTACATGGACTTCGTGGCTGCCCAGTGTCTGGTTTCCATTTCGAACCGCGCTGCGGTGCCGGAGCATGGGGTCGCTCCGGACGCCGAGCGGCTGCGACTACCTGAGCGCGAGGTGACCAAGGAGCACGGTGACCCGGGGGACACCTGGAAGGATTACTGCACACTGGTCACCATCGCCAAGAGCTTGTTGGACCTGAACAAGTACCGACCCATCCAGACCCCCTCCGTGTGCAGCGACAGTCTGGAAAGTCCAGATGAGGATATGGGATCCGACAGCGACGTGACCACCGAATCTGGGTCGAGTCCTTCCCACAGCCCGGAGGAGAGACAGGATCCTGGCAGCGCGCCCAGCCCGCTCTCCCTCCTCCATCCTGGAGTGGCTGCGAAGGGGAAACACGCCTCCGAAAAGAGGCACAAGTGCCCCTACAGTGGCTGTGGGAAAGTCTATGGAAAATCCTCCCATCTCAAAGCCCATTACAGAGTGCATACAGGTGAACGGCCCTTTCCCTGCACGTGGCCAGACTGCCTTAAAAAGTTCTCCCGCTCAGACGAGCTGACCCGCCACTACCGGACCCACACTGGGGAAAAGCAGTTCCGCTGTCCGCTGTGTGAGAAGCGCTTCATGAGGAGTGACCACCTCACAAAGCACGCCCGGCGGCACACCGAGTTCCACCCCAGCATGATCAAGCGATCGAAAAAGGCGCTGGCCAACGCTTTGTGA
ORF Protein Sequence MSAAAYMDFVAAQCLVSISNRAAVPEHGVAPDAERLRLPEREVTKEHGDPGDTWKDYCTLVTIAKSLLDLNKYRPIQTPSVCSDSLESPDEDMGSDSDVTTESGSSPSHSPEERQDPGSAPSPLSLLHPGVAAKGKHASEKRHKCPYSGCGKVYGKSSHLKAHYRVHTGERPFPCTWPDCLKKFSRSDELTRHYRTHTGEKQFRCPLCEKRFMRSDHLTKHARRHTEFHPSMIKRSKKALANAL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2176-Ab Anti-KLF9/ BTEB/ BTEB1 monoclonal antibody
    Target Antigen GM-Tg-g-MP2176-Ag KLF9 VLP (virus-like particle)
    ORF Viral Vector pGMLP001959 Human KLF9 Lentivirus plasmid
    ORF Viral Vector vGMLP001959 Human KLF9 Lentivirus particle


    Target information

    Target ID GM-MP2176
    Target Name KLF9
    Gene ID 687, 16601, 700585, 117560, 101090808, 484172, 539139, 100050300
    Gene Symbol and Synonyms 2310051E17Rik,BTEB,BTEB-1,BTEB1,Gm9971,KLF9
    Uniprot Accession Q13886
    Uniprot Entry Name KLF9_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000119138
    Target Classification Not Available

    The protein encoded by this gene is a transcription factor that binds to GC box elements located in the promoter. Binding of the encoded protein to a single GC box inhibits mRNA expression while binding to tandemly repeated GC box elements activates transcription. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.