Human TNFSF12/APO3L/ DR3LG ORF/cDNA clone-Lentivirus particle (NM_003809.2)
Pre-made Human TNFSF12/APO3L/ DR3LG Lentiviral expression plasmid for TNFSF12 lentivirus packaging, TNFSF12 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to TWEAK/TNFSF12/APO3L products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002011 | Human TNFSF12 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002011 |
Gene Name | TNFSF12 |
Accession Number | NM_003809.2 |
Gene ID | 8742 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 750 bp |
Gene Alias | APO3L, DR3LG, TNLG4A, TWEAK |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCGCCCGTCGGAGCCAGAGGCGGAGGGGGCGCCGGGGGGAGCCGGGCACCGCCCTGCTGGTCCCGCTCGCGCTGGGCCTGGGCCTGGCGCTGGCCTGCCTCGGCCTCCTGCTGGCCGTGGTCAGTTTGGGGAGCCGGGCATCGCTGTCCGCCCAGGAGCCTGCCCAGGAGGAGCTGGTGGCAGAGGAGGACCAGGACCCGTCGGAACTGAATCCCCAGACAGAAGAAAGCCAGGATCCTGCGCCTTTCCTGAACCGACTAGTTCGGCCTCGCAGAAGTGCACCTAAAGGCCGGAAAACACGGGCTCGAAGAGCGATCGCAGCCCATTATGAAGTTCATCCACGACCTGGACAGGACGGAGCGCAGGCAGGTGTGGACGGGACAGTGAGTGGCTGGGAGGAAGCCAGAATCAACAGCTCCAGCCCTCTGCGCTACAACCGCCAGATCGGGGAGTTTATAGTCACCCGGGCTGGGCTCTACTACCTGTACTGTCAGGTGCACTTTGATGAGGGGAAGGCTGTCTACCTGAAGCTGGACTTGCTGGTGGATGGTGTGCTGGCCCTGCGCTGCCTGGAGGAATTCTCAGCCACTGCGGCGAGTTCCCTCGGGCCCCAGCTCCGCCTCTGCCAGGTGTCTGGGCTGTTGGCCCTGCGGCCAGGGTCCTCCCTGCGGATCCGCACCCTCCCCTGGGCCCATCTCAAGGCTGCCCCCTTCCTCACCTACTTCGGACTCTTCCAGGTTCACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T46524-Ab | Anti-TNF12/ TWEAK/ TNFSF12 monoclonal antibody |
Target Antigen | GM-Tg-g-T46524-Ag | TWEAK/TNFSF12 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T46524 | Tumor necrosis factor superfamily member 12 (TNFSF12) protein & antibody |
ORF Viral Vector | pGMLP002011 | Human TNFSF12 Lentivirus plasmid |
ORF Viral Vector | vGMLP002011 | Human TNFSF12 Lentivirus particle |
Target information
Target ID | GM-T46524 |
Target Name | TWEAK |
Gene ID | 8742, 360548, 100551513, 100061872 |
Gene Symbol and Synonyms | APO3L,DR3LG,TNFSF12,TNLG4A,TWEAK |
Uniprot Accession | O43508 |
Uniprot Entry Name | TNF12_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Cytokine Target |
Disease | Prostate Cancer |
Gene Ensembl | ENSG00000239697 |
Target Classification | Not Available |
The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This protein is a ligand for the FN14/TWEAKR receptor. This cytokine has overlapping signaling functions with TNF, but displays a much wider tissue distribution. This cytokine, which exists in both membrane-bound and secreted forms, can induce apoptosis via multiple pathways of cell death in a cell type-specific manner. This cytokine is also found to promote proliferation and migration of endothelial cells, and thus acts as a regulator of angiogenesis. Alternative splicing results in multiple transcript variants. Some transcripts skip the last exon of this gene and continue into the second exon of the neighboring TNFSF13 gene; such read-through transcripts are contained in GeneID 407977, TNFSF12-TNFSF13. [provided by RefSeq, Oct 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.