Human TNFRSF10C/CD263/ DCR1 ORF/cDNA clone-Lentivirus particle (NM_003841)
Pre-made Human TNFRSF10C/CD263/ DCR1 Lentiviral expression plasmid for TNFRSF10C lentivirus packaging, TNFRSF10C lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to TNFRSF10C/CD263 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002252 | Human TNFRSF10C Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002252 |
Gene Name | TNFRSF10C |
Accession Number | NM_003841 |
Gene ID | 8794 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 780 bp |
Gene Alias | CD263, DCR1, DCR1-TNFR, LIT, TRAIL-R3, TRAILR3, TRID |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCCGGATCCCCAAGACCCTAAAGTTCGTCGTCGTCATCGTCGCGGTCCTGCTGCCAGTCCTAGCTTACTCTGCCACCACTGCCCGGCAGGAGGAAGTTCCCCAGCAGACAGTGGCCCCACAGCAACAGAGGCACAGCTTCAAGGGGGAGGAGTGTCCAGCAGGATCTCATAGATCAGAACATACTGGAGCCTGTAACCCGTGCACAGAGGGTGTGGATTACACCAACGCTTCCAACAATGAACCTTCTTGCTTCCCATGTACAGTTTGTAAATCAGATCAAAAACATAAAAGTTCCTGCACCATGACCAGAGACACAGTGTGTCAGTGTAAAGAAGGCACCTTCCGGAATGAAAACTCCCCAGAGATGTGCCGGAAGTGTAGCAGGTGCCCTAGTGGGGAAGTCCAAGTCAGTAATTGTACGTCCTGGGATGATATCCAGTGTGTTGAAGAATTTGGTGCCAATGCCACTGTGGAAACCCCAGCTGCTGAAGAGACAATGAACACCAGCCCGGGGACTCCTGCCCCAGCTGCTGAAGAGACAATGAACACCAGCCCAGGGACTCCTGCCCCAGCTGCTGAAGAGACAATGACCACCAGCCCGGGGACTCCTGCCCCAGCTGCTGAAGAGACAATGACCACCAGCCCGGGGACTCCTGCCCCAGCTGCTGAAGAGACAATGACCACCAGCCCGGGGACTCCTGCCTCTTCTCATTACCTCTCATGCACCATCGTAGGGATCATAGTTCTAATTGTGCTTCTGATTGTGTTTGTTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP1854-Ab | Anti-TR10C/ TNFRSF10C/ CD263 monoclonal antibody |
Target Antigen | GM-Tg-g-MP1854-Ag | TNFRSF10C VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-MP1854 | tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain (TNFRSF10C) protein & antibody |
ORF Viral Vector | pGMLP002252 | Human TNFRSF10C Lentivirus plasmid |
ORF Viral Vector | vGMLP002252 | Human TNFRSF10C Lentivirus particle |
Target information
Target ID | GM-MP1854 |
Target Name | TNFRSF10C |
Gene ID | 8794, 100430035 |
Gene Symbol and Synonyms | CD263,DCR1,DCR1-TNFR,LIT,TNFRSF10C,TRAIL-R3,TRAILR3,TRID |
Uniprot Accession | O14798 |
Uniprot Entry Name | TR10C_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000173535 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contains an extracellular TRAIL-binding domain and a transmembrane domain, but no cytoplasmic death domain. This receptor is not capable of inducing apoptosis, and is thought to function as an antagonistic receptor that protects cells from TRAIL-induced apoptosis. This gene was found to be a p53-regulated DNA damage-inducible gene. The expression of this gene was detected in many normal tissues but not in most cancer cell lines, which may explain the specific sensitivity of cancer cells to the apoptosis-inducing activity of TRAIL. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.