Human LAMTOR1/C11orf59/p18 ORF/cDNA clone-Lentivirus particle (NM_017907)

Cat. No.: vGMLP002527

Pre-made Human LAMTOR1/C11orf59/p18 Lentiviral expression plasmid for LAMTOR1 lentivirus packaging, LAMTOR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to LAMTOR1/C11orf59 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002527 Human LAMTOR1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002527
Gene Name LAMTOR1
Accession Number NM_017907
Gene ID 55004
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 486 bp
Gene Alias C11orf59,p18,p27RF-Rho,PDRO,Ragulator1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGTGCTGCTACAGCAGCGAGAACGAGGACTCGGACCAGGACCGAGAGGAGCGGAAGCTGCTGCTGGACCCTAGCAGCCCCCCTACCAAAGCTCTCAATGGAGCCGAGCCCAACTACCACAGCCTGCCTTCCGCTCGCACTGATGAGCAGGCCCTGCTCTCTTCCATCCTTGCCAAGACAGCCAGCAACATCATTGATGTGTCTGCTGCAGACTCACAGGGCATGGAGCAGCATGAGTACATGGACCGTGCCAGGCAGTACAGCACCCGCTTGGCTGTGCTGAGCAGCAGCCTGACCCATTGGAAGAAGCTGCCACCGCTGCCGTCTCTTACCAGCCAGCCCCACCAAGTGCTGGCCAGTGAGCCCATCCCGTTCTCTGATTTGCAGCAGGTCTCCAGGATAGCTGCTTATGCCTACAGTGCACTTTCTCAGATCCGTGTGGACGCAAAAGAGGAGCTGGTTGTACAGTTTGGGATCCCATGA
ORF Protein Sequence MGCCYSSENEDSDQDREERKLLLDPSSPPTKALNGAEPNYHSLPSARTDEQALLSSILAKTASNIIDVSAADSQGMEQHEYMDRARQYSTRLAVLSSSLTHWKKLPPLPSLTSQPHQVLASEPIPFSDLQQVSRIAAYAYSALSQIRVDAKEELVVQFGIP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2181-Ab Anti-LTOR1/ LAMTOR1/ C11orf59 monoclonal antibody
    Target Antigen GM-Tg-g-MP2181-Ag LAMTOR1 VLP (virus-like particle)
    ORF Viral Vector pGMLP002527 Human LAMTOR1 Lentivirus plasmid
    ORF Viral Vector vGMLP002527 Human LAMTOR1 Lentivirus particle


    Target information

    Target ID GM-MP2181
    Target Name LAMTOR1
    Gene ID 55004, 66508, 718249, 308869, 101085237, 485211, 614849, 100052779
    Gene Symbol and Synonyms 2400001E08Rik,C11orf59,C15H11orf59,LAMTOR1,p18,p27RF-Rho,PDRO,Ragulator1
    Uniprot Accession Q6IAA8
    Uniprot Entry Name LTOR1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Malignant neoplasm of prostate
    Gene Ensembl ENSG00000149357
    Target Classification Not Available

    Enables GTPase binding activity. Contributes to guanyl-nucleotide exchange factor activity and molecular adaptor activity. Involved in several processes, including cholesterol homeostasis; positive regulation of TOR signaling; and regulation of cholesterol transport. Located in lysosome. Part of Ragulator complex. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.