Human OPRD1/OPRD ORF/cDNA clone-Lentivirus particle (NM_000911)

Pre-made Human OPRD1/OPRD Lentiviral expression plasmid for OPRD1 lentivirus packaging, OPRD1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to OPRD1/OPRD products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002987 Human OPRD1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002987
Gene Name OPRD1
Accession Number NM_000911
Gene ID 4985
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1119 bp
Gene Alias OPRD
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAACCGGCCCCCTCCGCCGGCGCCGAGCTGCAGCCCCCGCTCTTCGCCAACGCCTCGGACGCCTACCCTAGCGCCTGCCCCAGCGCTGGCGCCAATGCGTCGGGGCCGCCAGGCGCGCGGAGCGCCTCGTCCCTCGCCCTGGCAATCGCCATCACCGCGCTCTACTCGGCCGTGTGCGCCGTGGGGCTGCTGGGCAACGTGCTTGTCATGTTCGGCATCGTCCGGTACACTAAGATGAAGACGGCCACCAACATCTACATCTTCAACCTGGCCTTAGCCGATGCGCTGGCCACCAGCACGCTGCCTTTCCAGAGTGCCAAGTACCTGATGGAGACGTGGCCCTTCGGCGAGCTGCTCTGCAAGGCTGTGCTCTCCATCGACTACTACAATATGTTCACCAGCATCTTCACGCTCACCATGATGAGTGTTGACCGCTACATCGCTGTCTGCCACCCTGTCAAGGCCCTGGACTTCCGCACGCCTGCCAAGGCCAAGCTGATCAACATCTGTATCTGGGTCCTGGCCTCAGGCGTTGGCGTGCCCATCATGGTCATGGCTGTGACCCGTCCCCGGGACGGGGCAGTGGTGTGCATGCTCCAGTTCCCCAGCCCCAGCTGGTACTGGGACACGGTGACCAAGATCTGCGTGTTCCTCTTCGCCTTCGTGGTGCCCATCCTCATCATCACCGTGTGCTATGGCCTCATGCTGCTGCGCCTGCGCAGTGTGCGCCTGCTGTCGGGCTCCAAGGAGAAGGACCGCAGCCTGCGGCGCATCACGCGCATGGTGCTGGTGGTTGTGGGCGCCTTCGTGGTGTGTTGGGCGCCCATCCACATCTTCGTCATCGTCTGGACGCTGGTGGACATCGACCGGCGCGACCCGCTGGTGGTGGCTGCGCTGCACCTGTGCATCGCGCTGGGCTACGCCAATAGCAGCCTCAACCCCGTGCTCTACGCTTTCCTCGACGAGAACTTCAAGCGCTGCTTCCGCCAGCTCTGCCGCAAGCCCTGCGGCCGCCCAGACCCCAGCAGCTTCAGCCGCGCCCGCGAAGCCACGGCCCGCGAGCGTGTCACCGCCTGCACCCCGTCCGATGGTCCCGGCGGTGGCGCTGCCGCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T58992-Ab Anti-OPRD/ OPRD1/ DOP monoclonal antibody
    Target Antigen GM-Tg-g-T58992-Ag OPRD1 VLP (virus-like particle)
    ORF Viral Vector pGMLP002987 Human OPRD1 Lentivirus plasmid
    ORF Viral Vector vGMLP002987 Human OPRD1 Lentivirus particle


    Target information

    Target ID GM-T58992
    Target Name OPRD1
    Gene ID 4985, 18386, 717256, 24613, 101088861, 487329, 781956, 100070646
    Gene Symbol and Synonyms DOP,DOR,DOR-1,DOR1,mDOR,Nbor,OPRD,OPRD1
    Uniprot Accession P41143
    Uniprot Entry Name OPRD_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000116329
    Target Classification GPCR

    Enables G protein-coupled enkephalin receptor activity. Involved in several processes, including G protein-coupled opioid receptor signaling pathway; cellular response to hypoxia; and positive regulation of peptidyl-serine phosphorylation. Is intrinsic component of plasma membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.