Human OPRD1/OPRD ORF/cDNA clone-Lentivirus particle (NM_000911)
Pre-made Human OPRD1/OPRD Lentiviral expression plasmid for OPRD1 lentivirus packaging, OPRD1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to OPRD1/OPRD products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002987 | Human OPRD1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002987 |
Gene Name | OPRD1 |
Accession Number | NM_000911 |
Gene ID | 4985 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1119 bp |
Gene Alias | OPRD |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAACCGGCCCCCTCCGCCGGCGCCGAGCTGCAGCCCCCGCTCTTCGCCAACGCCTCGGACGCCTACCCTAGCGCCTGCCCCAGCGCTGGCGCCAATGCGTCGGGGCCGCCAGGCGCGCGGAGCGCCTCGTCCCTCGCCCTGGCAATCGCCATCACCGCGCTCTACTCGGCCGTGTGCGCCGTGGGGCTGCTGGGCAACGTGCTTGTCATGTTCGGCATCGTCCGGTACACTAAGATGAAGACGGCCACCAACATCTACATCTTCAACCTGGCCTTAGCCGATGCGCTGGCCACCAGCACGCTGCCTTTCCAGAGTGCCAAGTACCTGATGGAGACGTGGCCCTTCGGCGAGCTGCTCTGCAAGGCTGTGCTCTCCATCGACTACTACAATATGTTCACCAGCATCTTCACGCTCACCATGATGAGTGTTGACCGCTACATCGCTGTCTGCCACCCTGTCAAGGCCCTGGACTTCCGCACGCCTGCCAAGGCCAAGCTGATCAACATCTGTATCTGGGTCCTGGCCTCAGGCGTTGGCGTGCCCATCATGGTCATGGCTGTGACCCGTCCCCGGGACGGGGCAGTGGTGTGCATGCTCCAGTTCCCCAGCCCCAGCTGGTACTGGGACACGGTGACCAAGATCTGCGTGTTCCTCTTCGCCTTCGTGGTGCCCATCCTCATCATCACCGTGTGCTATGGCCTCATGCTGCTGCGCCTGCGCAGTGTGCGCCTGCTGTCGGGCTCCAAGGAGAAGGACCGCAGCCTGCGGCGCATCACGCGCATGGTGCTGGTGGTTGTGGGCGCCTTCGTGGTGTGTTGGGCGCCCATCCACATCTTCGTCATCGTCTGGACGCTGGTGGACATCGACCGGCGCGACCCGCTGGTGGTGGCTGCGCTGCACCTGTGCATCGCGCTGGGCTACGCCAATAGCAGCCTCAACCCCGTGCTCTACGCTTTCCTCGACGAGAACTTCAAGCGCTGCTTCCGCCAGCTCTGCCGCAAGCCCTGCGGCCGCCCAGACCCCAGCAGCTTCAGCCGCGCCCGCGAAGCCACGGCCCGCGAGCGTGTCACCGCCTGCACCCCGTCCGATGGTCCCGGCGGTGGCGCTGCCGCCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T58992-Ab | Anti-OPRD/ OPRD1/ DOP monoclonal antibody |
Target Antigen | GM-Tg-g-T58992-Ag | OPRD1 VLP (virus-like particle) |
ORF Viral Vector | pGMLP002987 | Human OPRD1 Lentivirus plasmid |
ORF Viral Vector | vGMLP002987 | Human OPRD1 Lentivirus particle |
Target information
Target ID | GM-T58992 |
Target Name | OPRD1 |
Gene ID | 4985, 18386, 717256, 24613, 101088861, 487329, 781956, 100070646 |
Gene Symbol and Synonyms | DOP,DOR,DOR-1,DOR1,mDOR,Nbor,OPRD,OPRD1 |
Uniprot Accession | P41143 |
Uniprot Entry Name | OPRD_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000116329 |
Target Classification | GPCR |
Enables G protein-coupled enkephalin receptor activity. Involved in several processes, including G protein-coupled opioid receptor signaling pathway; cellular response to hypoxia; and positive regulation of peptidyl-serine phosphorylation. Is intrinsic component of plasma membrane. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.