Human ASIC3/ACCN3/ DRASIC ORF/cDNA clone-Lentivirus particle (NM_004769)
Pre-made Human ASIC3/ACCN3/ DRASIC Lentiviral expression plasmid for ASIC3 lentivirus packaging, ASIC3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to ASIC3/ACCN3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003357 | Human ASIC3 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003357 |
Gene Name | ASIC3 |
Accession Number | NM_004769 |
Gene ID | 9311 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1596 bp |
Gene Alias | ACCN3, DRASIC, SLNAC1, TNaC1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGCCCACCTCAGGCCCAGAGGAGGCCCGGCGGCCAGCCTCGGACATCCGCGTGTTCGCCAGCAACTGCTCGATGCACGGGCTGGGCCACGTCTTCGGGCCAGGCAGCCTGAGCCTGCGCCGGGGGATGTGGGCAGCGGCCGTGGTCCTGTCAGTGGCCACCTTCCTCTACCAGGTGGCTGAGAGGGTGCGCTACTACAGGGAGTTCCACCACCAGACTGCCCTGGATGAGCGAGAAAGCCACCGGCTCATCTTCCCGGCTGTCACCCTGTGCAACATCAACCCACTGCGCCGCTCGCGCCTAACGCCCAACGACCTGCACTGGGCTGGGTCTGCGCTGCTGGGCCTGGATCCCGCAGAGCACGCCGCCTTCCTGCGCGCCCTGGGCCGGCCCCCTGCACCGCCCGGCTTCATGCCCAGTCCCACCTTTGACATGGCGCAACTCTATGCCCGTGCTGGGCACTCCCTGGATGACATGCTGCTGGACTGTCGCTTCCGTGGCCAACCTTGTGGGCCTGAGAACTTCACCACGATCTTCACCCGGATGGGAAAGTGCTACACATTTAACTCTGGCGCTGATGGGGCAGAGCTGCTCACCACTACTAGGGGTGGCATGGGCAATGGGCTGGACATCATGCTGGACGTGCAGCAGGAGGAATATCTACCTGTGTGGAGGGACAATGAGGAGACCCCGTTTGAGGTGGGGATCCGAGTGCAGATCCACAGCCAGGAGGAGCCGCCCATCATCGATCAGCTGGGCTTGGGGGTGTCCCCGGGCTACCAGACCTTTGTTTCTTGCCAGCAGCAGCAGCTGAGCTTCCTGCCACCGCCCTGGGGCGATTGCAGTTCAGCATCTCTGAACCCCAACTATGAGCCAGAGCCCTCTGATCCCCTAGGCTCCCCCAGCCCCAGCCCCAGCCCTCCCTATACCCTTATGGGGTGTCGCCTGGCCTGCGAAACCCGCTACGTGGCTCGGAAGTGCGGCTGCCGAATGGTGTACATGCCAGGCGACGTGCCAGTGTGCAGCCCCCAGCAGTACAAGAACTGTGCCCACCCGGCCATAGATGCCATGCTTCGCAAGGACTCGTGCGCCTGCCCCAACCCGTGCGCCAGCACGCGCTACGCCAAGGAGCTCTCCATGGTGCGGATCCCGAGCCGCGCCGCCGCGCGCTTCCTGGCCCGGAAGCTCAACCGCAGCGAGGCCTACATCGCGGAGAACGTGCTGGCCCTGGACATCTTCTTTGAGGCCCTCAACTATGAGACCGTGGAGCAGAAGAAGGCCTATGAGATGTCAGAGCTGCTTGGTGACATTGGGGGCCAGATGGGGCTGTTCATCGGGGCCAGCCTGCTCACCATCCTCGAGATCCTAGACTACCTCTGTGAGGTGTTCCGAGACAAGGTCCTGGGATATTTCTGGAACCGACAGCACTCCCAAAGGCACTCCAGCACCAATCTGCTTCAGGAAGGGCTGGGCAGCCATCGAACCCAAGTTCCCCACCTCAGCCTGGGCCCCAGACCTCCCACCCCTCCCTGTGCCGTCACCAAGACTCTCTCCGCCTCCCACCGCACCTGCTACCTTGTCACACAGCTCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T95947-Ab | Anti-ASIC3/ ACCN3/ DRASIC monoclonal antibody |
Target Antigen | GM-Tg-g-T95947-Ag | ASIC3 VLP (virus-like particle) |
ORF Viral Vector | pGMLV000017 | Rat Asic3 Lentivirus plasmid |
ORF Viral Vector | pGMLP003357 | Human ASIC3 Lentivirus plasmid |
ORF Viral Vector | pGMAP000571 | Rat Asic3 Adenovirus plasmid |
ORF Viral Vector | vGMLV000017 | Rat Asic3 Lentivirus particle |
ORF Viral Vector | vGMLP003357 | Human ASIC3 Lentivirus particle |
ORF Viral Vector | vGMAP000571 | Rat Asic3 Adenovirus particle |
Target information
Target ID | GM-T95947 |
Target Name | ASIC3 |
Gene ID | 9311, 171209, 714396, 286920, 101096970, 482801, 789132, 100063408 |
Gene Symbol and Synonyms | ACCN3,ASIC3,DRASIC,SLNAC1,TNaC1 |
Uniprot Accession | Q9UHC3 |
Uniprot Entry Name | ASIC3_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000213199 |
Target Classification | Ion Channel |
This gene encodes a member of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. The members of this family are amiloride-sensitive sodium channels that contain intracellular N and C termini, two hydrophobic transmembrane regions, and a large extracellular loop, which has many cysteine residues with conserved spacing. The member encoded by this gene is an acid sensor and may play an important role in the detection of lasting pH changes. In addition, a heteromeric association between this member and acid-sensing (proton-gated) ion channel 2 has been observed as proton-gated channels sensitive to gadolinium. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.