Human ADORA3/A3AR ORF/cDNA clone-Lentivirus particle (NM_000677)
Pre-made Human ADORA3/A3AR Lentiviral expression plasmid for ADORA3 lentivirus packaging, ADORA3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to ADORA3/A3AR products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003536 | Human ADORA3 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003536 |
Gene Name | ADORA3 |
Accession Number | NM_000677 |
Gene ID | 140 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 957 bp |
Gene Alias | A3AR |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCCCAACAACAGCACTGCTCTGTCATTGGCCAATGTTACCTACATCACCATGGAAATTTTCATTGGACTCTGCGCCATAGTGGGCAACGTGCTGGTCATCTGCGTGGTCAAGCTGAACCCCAGCCTGCAGACCACCACCTTCTATTTCATTGTCTCTCTAGCCCTGGCTGACATTGCTGTTGGGGTGCTGGTCATGCCTTTGGCCATTGTTGTCAGCCTGGGCATCACAATCCACTTCTACAGCTGCCTTTTTATGACTTGCCTACTGCTTATCTTTACCCACGCCTCCATCATGTCCTTGCTGGCCATCGCTGTGGACCGATACTTGCGGGTCAAGCTTACCGTCAGATACAAGAGGGTCACCACTCACAGAAGAATATGGCTGGCCCTGGGCCTTTGCTGGCTGGTGTCATTCCTGGTGGGATTGACCCCCATGTTTGGCTGGAACATGAAACTGACCTCAGAGTACCACAGAAATGTCACCTTCCTTTCATGCCAATTTGTTTCCGTCATGAGAATGGACTACATGGTATACTTCAGCTTCCTCACCTGGATTTTCATCCCCCTGGTTGTCATGTGCGCCATCTATCTTGACATCTTTTACATCATTCGGAACAAACTCAGTCTGAACTTATCTAACTCCAAAGAGACAGGTGCATTTTATGGACGGGAGTTCAAGACGGCTAAGTCCTTGTTTCTGGTTCTTTTCTTGTTTGCTCTGTCATGGCTGCCTTTATCTATCATCAACTGCATCATCTACTTTAATGGTGAGGTACCACAGCTTGTGCTGTACATGGGCATCCTGCTGTCCCATGCCAACTCCATGATGAACCCTATCGTCTATGCCTATAAAATAAAGAAGTTCAAGGAAACCTACCTTTTGATCCTCAAAGCTTGTGTGGTCTGCCATCCCTCTGATTCTTTGGACACAAGCATTGAGAAGAATTCTGAGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T36059-Ab | Anti-AA3R/ ADORA3/ A3AR monoclonal antibody |
Target Antigen | GM-Tg-g-T36059-Ag | ADORA3 VLP (virus-like particle) |
ORF Viral Vector | pGMLP003536 | Human ADORA3 Lentivirus plasmid |
ORF Viral Vector | vGMLP003536 | Human ADORA3 Lentivirus particle |
Target information
Target ID | GM-T36059 |
Target Name | ADORA3 |
Gene ID | 140, 100911796, 101094689, 403805 |
Gene Symbol and Synonyms | A3,A3AR,ADORA3,TGPCR1 |
Uniprot Accession | P0DMS8 |
Uniprot Entry Name | AA3R_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target |
Disease | Not Available |
Gene Ensembl | ENSG00000282608 |
Target Classification | Checkpoint-Immuno Oncology, GPCR |
This gene encodes a protein that belongs to the family of adenosine receptors, which are G-protein-coupled receptors that are involved in a variety of intracellular signaling pathways and physiological functions. The receptor encoded by this gene mediates a sustained cardioprotective function during cardiac ischemia, it is involved in the inhibition of neutrophil degranulation in neutrophil-mediated tissue injury, it has been implicated in both neuroprotective and neurodegenerative effects, and it may also mediate both cell proliferation and cell death. Alternative splicing results in multiple transcript variants. This gene shares its 5' terminal exon with some transcripts from overlapping GeneID:57413, which encodes an immunoglobulin domain-containing protein. [provided by RefSeq, Nov 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.