Human ADORA3/A3AR ORF/cDNA clone-Lentivirus particle (NM_000677)

Cat. No.: vGMLP003536

Pre-made Human ADORA3/A3AR Lentiviral expression plasmid for ADORA3 lentivirus packaging, ADORA3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to ADORA3/A3AR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003536 Human ADORA3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003536
Gene Name ADORA3
Accession Number NM_000677
Gene ID 140
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 957 bp
Gene Alias A3AR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCCAACAACAGCACTGCTCTGTCATTGGCCAATGTTACCTACATCACCATGGAAATTTTCATTGGACTCTGCGCCATAGTGGGCAACGTGCTGGTCATCTGCGTGGTCAAGCTGAACCCCAGCCTGCAGACCACCACCTTCTATTTCATTGTCTCTCTAGCCCTGGCTGACATTGCTGTTGGGGTGCTGGTCATGCCTTTGGCCATTGTTGTCAGCCTGGGCATCACAATCCACTTCTACAGCTGCCTTTTTATGACTTGCCTACTGCTTATCTTTACCCACGCCTCCATCATGTCCTTGCTGGCCATCGCTGTGGACCGATACTTGCGGGTCAAGCTTACCGTCAGATACAAGAGGGTCACCACTCACAGAAGAATATGGCTGGCCCTGGGCCTTTGCTGGCTGGTGTCATTCCTGGTGGGATTGACCCCCATGTTTGGCTGGAACATGAAACTGACCTCAGAGTACCACAGAAATGTCACCTTCCTTTCATGCCAATTTGTTTCCGTCATGAGAATGGACTACATGGTATACTTCAGCTTCCTCACCTGGATTTTCATCCCCCTGGTTGTCATGTGCGCCATCTATCTTGACATCTTTTACATCATTCGGAACAAACTCAGTCTGAACTTATCTAACTCCAAAGAGACAGGTGCATTTTATGGACGGGAGTTCAAGACGGCTAAGTCCTTGTTTCTGGTTCTTTTCTTGTTTGCTCTGTCATGGCTGCCTTTATCTATCATCAACTGCATCATCTACTTTAATGGTGAGGTACCACAGCTTGTGCTGTACATGGGCATCCTGCTGTCCCATGCCAACTCCATGATGAACCCTATCGTCTATGCCTATAAAATAAAGAAGTTCAAGGAAACCTACCTTTTGATCCTCAAAGCTTGTGTGGTCTGCCATCCCTCTGATTCTTTGGACACAAGCATTGAGAAGAATTCTGAGTAG
ORF Protein Sequence MPNNSTALSLANVTYITMEIFIGLCAIVGNVLVICVVKLNPSLQTTTFYFIVSLALADIAVGVLVMPLAIVVSLGITIHFYSCLFMTCLLLIFTHASIMSLLAIAVDRYLRVKLTVRYKRVTTHRRIWLALGLCWLVSFLVGLTPMFGWNMKLTSEYHRNVTFLSCQFVSVMRMDYMVYFSFLTWIFIPLVVMCAIYLDIFYIIRNKLSLNLSNSKETGAFYGREFKTAKSLFLVLFLFALSWLPLSIINCIIYFNGEVPQLVLYMGILLSHANSMMNPIVYAYKIKKFKETYLLILKACVVCHPSDSLDTSIEKNSE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T36059-Ab Anti-AA3R/ ADORA3/ A3AR monoclonal antibody
    Target Antigen GM-Tg-g-T36059-Ag ADORA3 VLP (virus-like particle)
    ORF Viral Vector pGMLP003536 Human ADORA3 Lentivirus plasmid
    ORF Viral Vector vGMLP003536 Human ADORA3 Lentivirus particle


    Target information

    Target ID GM-T36059
    Target Name ADORA3
    Gene ID 140, 100911796, 101094689, 403805
    Gene Symbol and Synonyms A3,A3AR,ADORA3,TGPCR1
    Uniprot Accession P0DMS8
    Uniprot Entry Name AA3R_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Not Available
    Gene Ensembl ENSG00000282608
    Target Classification Checkpoint-Immuno Oncology, GPCR

    This gene encodes a protein that belongs to the family of adenosine receptors, which are G-protein-coupled receptors that are involved in a variety of intracellular signaling pathways and physiological functions. The receptor encoded by this gene mediates a sustained cardioprotective function during cardiac ischemia, it is involved in the inhibition of neutrophil degranulation in neutrophil-mediated tissue injury, it has been implicated in both neuroprotective and neurodegenerative effects, and it may also mediate both cell proliferation and cell death. Alternative splicing results in multiple transcript variants. This gene shares its 5' terminal exon with some transcripts from overlapping GeneID:57413, which encodes an immunoglobulin domain-containing protein. [provided by RefSeq, Nov 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.