Human CASP4/ICE(rel)II/ ICEREL-II ORF/cDNA clone-Lentivirus particle (NM_001225)

Pre-made Human CASP4/ICE(rel)II/ ICEREL-II Lentiviral expression plasmid for CASP4 lentivirus packaging, CASP4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CASP4/ICE(rel)II products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003610 Human CASP4 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003610
Gene Name CASP4
Accession Number NM_001225
Gene ID 837
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1134 bp
Gene Alias ICE(rel)II, ICEREL-II, ICH-2, Mih1, Mih1/TX, TX
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCAGAAGGCAACCACAGAAAAAAGCCACTTAAGGTGTTGGAATCCCTGGGCAAAGATTTCCTCACTGGTGTTTTGGATAACTTGGTGGAACAAAATGTACTGAACTGGAAGGAAGAGGAAAAAAAGAAATATTACGATGCTAAAACTGAAGACAAAGTTCGGGTCATGGCAGACTCTATGCAAGAGAAGCAACGTATGGCAGGACAAATGCTTCTTCAAACCTTTTTTAACATAGACCAAATATCCCCCAATAAAAAAGCTCATCCGAATATGGAGGCTGGACCACCTGAGTCAGGAGAATCTACAGATGCCCTCAAGCTTTGTCCTCATGAAGAATTCCTGAGACTATGTAAAGAAAGAGCTGAAGAGATCTATCCAATAAAGGAGAGAAACAACCGCACACGCCTGGCTCTCATCATATGCAATACAGAGTTTGACCATCTGCCTCCGAGGAATGGAGCTGACTTTGACATCACAGGGATGAAGGAGCTACTTGAGGGTCTGGACTATAGTGTAGATGTAGAAGAGAATCTGACAGCCAGGGATATGGAGTCAGCGCTGAGGGCATTTGCTACCAGACCAGAGCACAAGTCCTCTGACAGCACATTCTTGGTACTCATGTCTCATGGCATCCTGGAGGGAATCTGCGGAACTGTGCATGATGAGAAAAAACCAGATGTGCTGCTTTATGACACCATCTTCCAGATATTCAACAACCGCAACTGCCTCAGTCTGAAGGACAAACCCAAGGTCATCATTGTCCAGGCCTGCAGAGGTGCAAACCGTGGGGAACTGTGGGTCAGAGACTCTCCAGCATCCTTGGAAGTGGCCTCTTCACAGTCATCTGAGAACCTAGAGGAAGATGCTGTTTACAAGACCCACGTGGAGAAGGACTTCATTGCTTTCTGCTCTTCAACGCCACACAACGTGTCCTGGAGAGACAGCACAATGGGCTCTATCTTCATCACACAACTCATCACATGCTTCCAGAAATATTCTTGGTGCTGCCACCTAGAGGAAGTATTTCGGAAGGTACAGCAATCATTTGAAACTCCAAGGGCCAAAGCTCAAATGCCCACCATAGAACGACTGTCCATGACAAGATATTTCTACCTCTTTCCTGGCAATTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T53469-Ab Anti-CASP4/ ICE(rel)II/ ICEREL-II monoclonal antibody
    Target Antigen GM-Tg-g-T53469-Ag CASP4 VLP (virus-like particle)
    ORF Viral Vector pGMLP003610 Human CASP4 Lentivirus plasmid
    ORF Viral Vector vGMLP003610 Human CASP4 Lentivirus particle


    Target information

    Target ID GM-T53469
    Target Name CASP4
    Gene ID 837, 704864
    Gene Symbol and Synonyms CASP4,ICE(rel)II,ICEREL-II,ICH-2,Mih1,Mih1/TX,TX
    Uniprot Accession P49662
    Uniprot Entry Name CASP4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000196954
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a protein that is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes composed of a prodomain and a large and small protease subunit. Activation of caspases requires proteolytic processing at conserved internal aspartic residues to generate a heterodimeric enzyme consisting of the large and small subunits. This caspase is able to cleave and activate its own precursor protein, as well as caspase 1 precursor. When overexpressed, this gene induces cell apoptosis. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.