Human DRD3/D3DR/ ETM1 ORF/cDNA clone-Lentivirus particle (NM_001282563)

Pre-made Human DRD3/D3DR/ ETM1 Lentiviral expression plasmid for DRD3 lentivirus packaging, DRD3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to D3R/DRD3/D3DR products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003645 Human DRD3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003645
Gene Name DRD3
Accession Number NM_001282563
Gene ID 1814
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1203 bp
Gene Alias D3DR, ETM1, FET1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCATCTCTGAGCCAGCTGAGTGGCCACCTGAACTACACCTGTGGGGCAGAGAACTCCACAGGTGCCAGCCAGGCCCGCCCACATGCCTACTATGCCCTCTCCTACTGCGCGCTCATCCTGGCCATCGTCTTCGGCAATGGCCTGGTGTGCATGGCTGTGCTGAAGGAGCGGGCCCTGCAGACTACCACCAACTACTTAGTAGTGAGCCTGGCTGTGGCAGACTTGCTGGTGGCCACCTTGGTGATGCCCTGGGTGGTATACCTGGAGGTGACAGGTGGAGTCTGGAATTTCAGCCGCATTTGCTGTGATGTTTTTGTCACCCTGGATGTCATGATGTGTACAGCCAGCATCCTTAATCTCTGTGCCATCAGCATAGACAGGTACACTGCAGTGGTCATGCCCGTTCACTACCAGCATGGCACGGGACAGAGCTCCTGTCGGCGCGTGGCCCTCATGATCACGGCCGTCTGGGTACTGGCCTTTGCTGTGTCCTGCCCTCTTCTGTTTGGCTTTAATACCACAGGGGACCCCACTGTCTGCTCCATCTCCAACCCTGATTTTGTCATCTACTCTTCAGTGGTGTCCTTCTACCTGCCCTTTGGAGTGACTGTCCTTGTCTATGCCAGAATCTATGTGGTGCTGAAACAAAGGAGACGGAAAAGGATCCTCACTCGACAGAACAGTCAGTGCAACAGTGTCAGGCCTGGCTTCCCCCAACAAACCCTCTCTCCTGACCCGGCACATCTGGAGCTGAAGCGTTACTACAGCATCTGCCAGGACACTGCCTTGGGTGGACCAGGCTTCCAAGAAAGAGGAGGAGAGTTGAAAAGAGAGGAGAAGACTCGGAATTCCCTGAGTCCCACCATAGCGCCCAAGCTCAGCTTAGAAGTTCGAAAACTCAGCAATGGCAGATTATCGACATCTTTGAAGCTGGGGCCCCTGCAACCTCGGGGAGTGCCACTTCGGGAGAAGAAGGCAACCCAAATGGTGGCCATTGTGCTTGGGGCCTTCATTGTCTGCTGGCTGCCCTTCTTCTTGACCCATGTTCTCAATACCCACTGCCAGACATGCCACGTGTCCCCAGAGCTTTACAGTGCCACGACATGGCTGGGCTACGTGAATAGCGCCCTCAACCCTGTGATCTATACCACCTTCAATATCGAGTTCCGGAAAGCCTTCCTCAAGATCCTGTCTTGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T02551-Ab Anti-DRD3/ D3R/ D3DR monoclonal antibody
    Target Antigen GM-Tg-g-T02551-Ag D3R/DRD3 VLP (virus-like particle)
    ORF Viral Vector pGMLP003645 Human DRD3 Lentivirus plasmid
    ORF Viral Vector vGMLP003645 Human DRD3 Lentivirus particle


    Target information

    Target ID GM-T02551
    Target Name D3R
    Gene ID 1814, 13490, 100425047, 29238, 101092878, 487984, 537043, 100061160
    Gene Symbol and Synonyms D3DR,D3R,DRD3,ETM1,FET1
    Uniprot Accession P35462
    Uniprot Entry Name DRD3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000151577
    Target Classification Not Available

    This gene encodes the D3 subtype of the five (D1-D5) dopamine receptors. The activity of the D3 subtype receptor is mediated by G proteins which inhibit adenylyl cyclase. This receptor is localized to the limbic areas of the brain, which are associated with cognitive, emotional, and endocrine functions. Genetic variation in this gene may be associated with susceptibility to hereditary essential tremor 1. Alternative splicing of this gene results in transcript variants encoding different isoforms, although some variants may be subject to nonsense-mediated decay (NMD). [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.