Human ADRA2A/ADRA2/ADRA2R ORF/cDNA clone-Lentivirus particle (NM_000681)
Cat. No.: vGMLP003730
Pre-made Human ADRA2A/ADRA2/ADRA2R Lentiviral expression plasmid for ADRA2A lentivirus packaging, ADRA2A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
ADRA2A/ADRA2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP003730 | Human ADRA2A Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP003730 |
| Gene Name | ADRA2A |
| Accession Number | NM_000681 |
| Gene ID | 150 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1398 bp |
| Gene Alias | ADRA2,ADRA2R,ADRAR,ALPHA2AAR,ZNF32 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGTTCCGCCAGGAGCAGCCGTTGGCCGAGGGCAGCTTTGCGCCCATGGGCTCCCTGCAGCCGGACGCGGGCAACGCGAGCTGGAACGGGACCGAGGCGCCGGGGGGCGGCGCCCGGGCCACCCCTTACTCCCTGCAGGTGACGCTGACGCTGGTGTGCCTGGCCGGCCTGCTCATGCTGCTCACCGTGTTCGGCAACGTGCTCGTCATCATCGCCGTGTTCACGAGCCGCGCGCTCAAGGCGCCCCAAAACCTCTTCCTGGTGTCTCTGGCCTCGGCCGACATCCTGGTGGCCACGCTCGTCATCCCTTTCTCGCTGGCCAACGAGGTCATGGGCTACTGGTACTTCGGCAAGGCTTGGTGCGAGATCTACCTGGCGCTCGACGTGCTCTTCTGCACGTCGTCCATCGTGCACCTGTGCGCCATCAGCCTGGACCGCTACTGGTCCATCACACAGGCCATCGAGTACAACCTGAAGCGCACGCCGCGCCGCATCAAGGCCATCATCATCACCGTGTGGGTCATCTCGGCCGTCATCTCCTTCCCGCCGCTCATCTCCATCGAGAAGAAGGGCGGCGGCGGCGGCCCGCAGCCGGCCGAGCCGCGCTGCGAGATCAACGACCAGAAGTGGTACGTCATCTCGTCGTGCATCGGCTCCTTCTTCGCTCCCTGCCTCATCATGATCCTGGTCTACGTGCGCATCTACCAGATCGCCAAGCGTCGCACCCGCGTGCCACCCAGCCGCCGGGGTCCGGACGCCGTCGCCGCGCCGCCGGGGGGCACCGAGCGCAGGCCCAACGGTCTGGGCCCCGAGCGCAGCGCGGGCCCGGGGGGCGCAGAGGCCGAACCGCTGCCCACCCAGCTCAACGGCGCCCCTGGCGAGCCCGCGCCGGCCGGGCCGCGCGACACCGACGCGCTGGACCTGGAGGAGAGCTCGTCTTCCGACCACGCCGAGCGGCCTCCAGGGCCCCGCAGACCCGAGCGCGGTCCCCGGGGCAAAGGCAAGGCCCGAGCGAGCCAGGTGAAGCCGGGCGACAGCCTGCCGCGGCGCGGGCCGGGGGCGACGGGGATCGGGACGCCGGCTGCAGGGCCGGGGGAGGAGCGCGTCGGGGCTGCCAAGGCGTCGCGCTGGCGCGGGCGGCAGAACCGCGAGAAGCGCTTCACGTTCGTGCTGGCCGTGGTCATCGGAGTGTTCGTGGTGTGCTGGTTCCCCTTCTTCTTCACCTACACGCTCACGGCCGTCGGGTGCTCCGTGCCACGCACGCTCTTCAAATTCTTCTTCTGGTTCGGCTACTGCAACAGCTCGTTGAACCCGGTCATCTACACCATCTTCAACCACGATTTCCGCCGCGCCTTCAAGAAGATCCTCTGTCGGGGGGACAGGAAGCGGATCGTGTGA |
| ORF Protein Sequence | MFRQEQPLAEGSFAPMGSLQPDAGNASWNGTEAPGGGARATPYSLQVTLTLVCLAGLLMLLTVFGNVLVIIAVFTSRALKAPQNLFLVSLASADILVATLVIPFSLANEVMGYWYFGKAWCEIYLALDVLFCTSSIVHLCAISLDRYWSITQAIEYNLKRTPRRIKAIIITVWVISAVISFPPLISIEKKGGGGGPQPAEPRCEINDQKWYVISSCIGSFFAPCLIMILVYVRIYQIAKRRTRVPPSRRGPDAVAAPPGGTERRPNGLGPERSAGPGGAEAEPLPTQLNGAPGEPAPAGPRDTDALDLEESSSSDHAERPPGPRRPERGPRGKGKARASQVKPGDSLPRRGPGATGIGTPAAGPGEERVGAAKASRWRGRQNREKRFTFVLAVVIGVFVVCWFPFFFTYTLTAVGCSVPRTLFKFFFWFGYCNSSLNPVIYTIFNHDFRRAFKKILCRGDRKRIV |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T11448-Ab | Anti-ADA2A/ ADRA2A/ ADRA2 monoclonal antibody |
| Target Antigen | GM-Tg-g-T11448-Ag | ADRA2A VLP (virus-like particle) |
| ORF Viral Vector | pGMLP003730 | Human ADRA2A Lentivirus plasmid |
| ORF Viral Vector | vGMLP003730 | Human ADRA2A Lentivirus particle |
Target information
| Target ID | GM-T11448 |
| Target Name | ADRA2A |
| Gene ID | 150, 11551, 695684, 25083, 664736, 486888, 282135, 100147119 |
| Gene Symbol and Synonyms | Adra-2,Adra-2a,ADRA2,ADRA2A,ADRA2R,ADRAR,alpha(2A)AR,alpha2-C10,alpha2A,alpha2A-AR,ALPHA2AAR,CA2-47,RATRG20,RG20,ZNF32 |
| Uniprot Accession | P08913 |
| Uniprot Entry Name | ADA2A_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000150594 |
| Target Classification | GPCR |
Alpha-2-adrenergic receptors are members of the G protein-coupled receptor superfamily. The alpha-2-adrenergic receptors are a type of adrenergic receptors (for adrenaline or epinephrine), which inhibit adenylate cyclase. These receptors include 3 highly homologous subtypes: alpha2A, alpha2B, and alpha2C. They are involved in regulating the release of neurotransmitter molecules from sympathetic nerves and from adrenergic neurons in the central nervous system. The sympathetic nervous system regulates cardiovascular function by activating adrenergic receptors in the heart, blood vessels and kidney. Studies in mouse revealed that both the alpha2A and alpha2C receptor subtypes were required for presynaptic transmitter release from the sympathetic nervous system in the heart and from central noradrenergic neurons. The alpha-2-adrenergic receptors are also involved in catecholamine signaling by extracellular regulated protein kinase 1 and 2 (ERK1/2) pathways. A clear association between the alpha-2-adrenergic receptor and disease has not been yet established. [provided by RefSeq, Sep 2019]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


