Human FGFBP1/FGFBP/ HBP17 ORF/cDNA clone-Lentivirus particle (BC008910)
Pre-made Human FGFBP1/FGFBP/ HBP17 Lentiviral expression plasmid for FGFBP1 lentivirus packaging, FGFBP1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to FGFBP1/FGFBP products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003920 | Human FGFBP1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003920 |
Gene Name | FGFBP1 |
Accession Number | BC008910 |
Gene ID | 9982 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 705 bp |
Gene Alias | FGFBP, HBP17 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGATCTGTAGCCTCACCCTGCTCTCCTTCCTCCTACTGGCTGCTCAGGTGCTCCTGGTGGAGGGAAAAAAAAAAGTGAAGAATGGACTTCACAGCAAAGTGGTCTCAGAACAAAAGGACACTCTGGGCAACACCCAGATTAAGCAGAAAAGCAGGCCCGGGAACAAAGGCAAGTTTGTCACCAAAGACCAAGCCAACTGCAGATGGGCTGCTACTGAGCAGGAGGAGGGCATCTCTCTCAAGGTTGAGTGCACTCAATTGGACCATGAATTTTCCTGTGTCTTTGCTGGCAATCCAACCTCATGCCTAAAGCTCAAGGATGAGAGAGTCTATTGGAAACAAGTTGCCCGGAATCTGCGCTCACAGAAAGACATCTGTAGATATTCCAAGACAGCTGTGAAAACCAGAGTGTGCAGAAAGGATTTTCCAGAATCCAGTCTTAAGCTAGTCAGCTCCACTCTATTTGGGAACACAAAGCCCAGGAAGGAGAAAACAGAGATGTCCCCCAGGGAGCACATCAAGGGCAAAGAGACCACCCCCTCTAGCCTAGCAGTGACCCAGACCATGGCCACCAAAGCTCCCGAGTGTGTGGAGGACCCAGATATGGCAAACCAGAGGAAGACTGCCCTGGAGTTCTGTGGAGAGACTTGGAGCTCTCTCTGCACATTCTTCCTCAGCATAGTGCAGGACACGTCATGCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T43605-Ab | Anti-FGFP1/ FGFBP1/ FGF-BP monoclonal antibody |
Target Antigen | GM-Tg-g-T43605-Ag | FGFBP1 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T43605 | fibroblast growth factor binding protein 1 (FGFBP1) protein & antibody |
ORF Viral Vector | pGMLP001293 | Human FGFBP1 Lentivirus plasmid |
ORF Viral Vector | pGMLP003920 | Human FGFBP1 Lentivirus plasmid |
ORF Viral Vector | pGMLP003986 | Human FGFBP1 Lentivirus plasmid |
ORF Viral Vector | vGMLP001293 | Human FGFBP1 Lentivirus particle |
ORF Viral Vector | vGMLP003920 | Human FGFBP1 Lentivirus particle |
ORF Viral Vector | vGMLP003986 | Human FGFBP1 Lentivirus particle |
Target information
Target ID | GM-T43605 |
Target Name | FGFBP1 |
Gene ID | 9982, 14181, 714505, 64535, 101094417, 488818 |
Gene Symbol and Synonyms | FGF-BP,FGF-BP1,FGFBP,FGFBP-1,FGFBP1,HBP17 |
Uniprot Accession | Q14512 |
Uniprot Entry Name | FGFP1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000137440 |
Target Classification | Not Available |
This gene encodes a secreted fibroblast growth factor carrier protein. The encoded protein plays a critical role in cell proliferation, differentiation and migration by binding to fibroblast growth factors and potentiating their biological effects on target cells. The encoded protein may also play a role in tumor growth as an angiogenic switch molecule, and expression of this gene has been associated with several types of cancer including pancreatic and colorectal adenocarcinoma. A pseudogene of this gene is also located on the short arm of chromosome 4. [provided by RefSeq, Nov 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.