Human FGFBP1/FGFBP/ HBP17 ORF/cDNA clone-Lentivirus particle (BC008910)

Pre-made Human FGFBP1/FGFBP/ HBP17 Lentiviral expression plasmid for FGFBP1 lentivirus packaging, FGFBP1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to FGFBP1/FGFBP products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003920 Human FGFBP1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003920
Gene Name FGFBP1
Accession Number BC008910
Gene ID 9982
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 705 bp
Gene Alias FGFBP, HBP17
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGATCTGTAGCCTCACCCTGCTCTCCTTCCTCCTACTGGCTGCTCAGGTGCTCCTGGTGGAGGGAAAAAAAAAAGTGAAGAATGGACTTCACAGCAAAGTGGTCTCAGAACAAAAGGACACTCTGGGCAACACCCAGATTAAGCAGAAAAGCAGGCCCGGGAACAAAGGCAAGTTTGTCACCAAAGACCAAGCCAACTGCAGATGGGCTGCTACTGAGCAGGAGGAGGGCATCTCTCTCAAGGTTGAGTGCACTCAATTGGACCATGAATTTTCCTGTGTCTTTGCTGGCAATCCAACCTCATGCCTAAAGCTCAAGGATGAGAGAGTCTATTGGAAACAAGTTGCCCGGAATCTGCGCTCACAGAAAGACATCTGTAGATATTCCAAGACAGCTGTGAAAACCAGAGTGTGCAGAAAGGATTTTCCAGAATCCAGTCTTAAGCTAGTCAGCTCCACTCTATTTGGGAACACAAAGCCCAGGAAGGAGAAAACAGAGATGTCCCCCAGGGAGCACATCAAGGGCAAAGAGACCACCCCCTCTAGCCTAGCAGTGACCCAGACCATGGCCACCAAAGCTCCCGAGTGTGTGGAGGACCCAGATATGGCAAACCAGAGGAAGACTGCCCTGGAGTTCTGTGGAGAGACTTGGAGCTCTCTCTGCACATTCTTCCTCAGCATAGTGCAGGACACGTCATGCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T43605-Ab Anti-FGFP1/ FGFBP1/ FGF-BP monoclonal antibody
    Target Antigen GM-Tg-g-T43605-Ag FGFBP1 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T43605 fibroblast growth factor binding protein 1 (FGFBP1) protein & antibody
    ORF Viral Vector pGMLP001293 Human FGFBP1 Lentivirus plasmid
    ORF Viral Vector pGMLP003920 Human FGFBP1 Lentivirus plasmid
    ORF Viral Vector pGMLP003986 Human FGFBP1 Lentivirus plasmid
    ORF Viral Vector vGMLP001293 Human FGFBP1 Lentivirus particle
    ORF Viral Vector vGMLP003920 Human FGFBP1 Lentivirus particle
    ORF Viral Vector vGMLP003986 Human FGFBP1 Lentivirus particle


    Target information

    Target ID GM-T43605
    Target Name FGFBP1
    Gene ID 9982, 14181, 714505, 64535, 101094417, 488818
    Gene Symbol and Synonyms FGF-BP,FGF-BP1,FGFBP,FGFBP-1,FGFBP1,HBP17
    Uniprot Accession Q14512
    Uniprot Entry Name FGFP1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000137440
    Target Classification Not Available

    This gene encodes a secreted fibroblast growth factor carrier protein. The encoded protein plays a critical role in cell proliferation, differentiation and migration by binding to fibroblast growth factors and potentiating their biological effects on target cells. The encoded protein may also play a role in tumor growth as an angiogenic switch molecule, and expression of this gene has been associated with several types of cancer including pancreatic and colorectal adenocarcinoma. A pseudogene of this gene is also located on the short arm of chromosome 4. [provided by RefSeq, Nov 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.