Human TNFRSF4/ACT35/ CD134 ORF/cDNA clone-Lentivirus particle (NM_003327)

Pre-made Human TNFRSF4/ACT35/ CD134 Lentiviral expression plasmid for TNFRSF4 lentivirus packaging, TNFRSF4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CD134/TNFRSF4/ACT35 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003939 Human TNFRSF4 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003939
Gene Name TNFRSF4
Accession Number NM_003327
Gene ID 7293
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 834 bp
Gene Alias ACT35, CD134, IMD16, OX40, TXGP1L
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTGCGTGGGGGCTCGGCGGCTGGGCCGCGGGCCGTGTGCGGCTCTGCTCCTCCTGGGCCTGGGGCTGAGCACCGTGACGGGGCTCCACTGTGTCGGGGACACCTACCCCAGCAACGACCGGTGCTGCCACGAGTGCAGGCCAGGCAACGGGATGGTGAGCCGCTGCAGCCGCTCCCAGAACACGGTGTGCCGTCCGTGCGGGCCGGGCTTCTACAACGACGTGGTCAGCTCCAAGCCGTGCAAGCCCTGCACGTGGTGTAACCTCAGAAGTGGGAGTGAGCGGAAGCAGCTGTGCACGGCCACACAGGACACAGTCTGCCGCTGCCGGGCGGGCACCCAGCCCCTGGACAGCTACAAGCCTGGAGTTGACTGTGCCCCCTGCCCTCCAGGGCACTTCTCCCCAGGCGACAACCAGGCCTGCAAGCCCTGGACCAACTGCACCTTGGCTGGGAAGCACACCCTGCAGCCGGCCAGCAATAGCTCGGACGCAATCTGTGAGGACAGGGACCCCCCAGCCACGCAGCCCCAGGAGACCCAGGGCCCCCCGGCCAGGCCCATCACTGTCCAGCCCACTGAAGCCTGGCCCAGAACCTCACAGGGACCCTCCACCCGGCCCGTGGAGGTCCCCGGGGGCCGTGCGGTTGCCGCCATCCTGGGCCTGGGCCTGGTGCTGGGGCTGCTGGGCCCCCTGGCCATCCTGCTGGCCCTGTACCTGCTCCGGAGGGACCAGAGGCTGCCCCCCGATGCCCACAAGCCCCCTGGGGGAGGCAGTTTCCGGACCCCCATCCAAGAGGAGCAGGCCGACGCCCACTCCACCCTGGCCAAGATCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-126 Pre-Made Cudarolimab biosimilar, Whole mAb, Anti-TNFRSF4/CD134 Antibody: Anti-ACT35/IMD16/OX40/TXGP1L therapeutic antibody
    Biosimilar GMP-Bios-ab-482 Pre-Made Revdofilimab biosimilar, Whole mAb, Anti-TNFRSF4/CD134 Antibody: Anti-ACT35/IMD16/OX40/TXGP1L therapeutic antibody
    Biosimilar GMP-Bios-ab-448 Pre-Made Pogalizumab biosimilar, Whole mAb, Anti-TNFRSF4/CD134 Antibody: Anti-ACT35/IMD16/OX40/TXGP1L therapeutic antibody
    Biosimilar GMP-Bios-ab-690 Pre-Made Rocatinlimab biosimilar, Whole mAb, Anti-TNFRSF4/CD134 Antibody: Anti-ACT35/IMD16/OX40/TXGP1L therapeutic antibody
    Biosimilar GMP-Bios-ab-285 Pre-Made Ivuxolimab biosimilar, Whole mAb, Anti-TNFRSF4/CD134 Antibody: Anti-ACT35/IMD16/OX40/TXGP1L therapeutic antibody
    Biosimilar GMP-Bios-ab-628 Pre-Made Vonlerolizumab biosimilar, Whole mAb, Anti-TNFRSF4/CD134 Antibody: Anti-ACT35/IMD16/OX40/TXGP1L therapeutic antibody
    Biosimilar GMP-Bios-ab-558 Pre-Made Telazorlimab biosimilar, Whole mAb, Anti-TNFRSF4/CD134 Antibody: Anti-ACT35/IMD16/OX40/TXGP1L therapeutic antibody
    Target Antibody GM-Tg-g-T92124-Ab Anti-TNR4/ CD134/ TNFRSF4 monoclonal antibody
    Target Antigen GM-Tg-g-T92124-Ag CD134/TNFRSF4 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T92124 tumor necrosis factor receptor superfamily, member 4 (TNFRSF4) protein & antibody
    ORF Viral Vector pGMLP003939 Human TNFRSF4 Lentivirus plasmid
    ORF Viral Vector vGMLP003939 Human TNFRSF4 Lentivirus particle


    Target information

    Target ID GM-T92124
    Target Name CD134
    Gene ID 7293, 22163, 699674, 25572, 493665, 489600, 528782, 100066167
    Gene Symbol and Synonyms ACT35,CD134,IMD16,Ly-70,OX40,TNFRSF4,Txgp1,TXGP1L
    Uniprot Accession P43489
    Uniprot Entry Name TNR4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000186827
    Target Classification Checkpoint-Immuno Oncology, GPCR

    The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor has been shown to activate NF-kappaB through its interaction with adaptor proteins TRAF2 and TRAF5. Knockout studies in mice suggested that this receptor promotes the expression of apoptosis inhibitors BCL2 and BCL2lL1/BCL2-XL, and thus suppresses apoptosis. The knockout studies also suggested the roles of this receptor in CD4+ T cell response, as well as in T cell-dependent B cell proliferation and differentiation. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.