Human MRAP2/bA51G5.2/C6orf117 ORF/cDNA clone-Lentivirus particle (NM_001346544)

Cat. No.: vGMLP004128

Pre-made Human MRAP2/bA51G5.2/C6orf117 Lentiviral expression plasmid for MRAP2 lentivirus packaging, MRAP2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to MRAP2/bA51G5.2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004128 Human MRAP2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004128
Gene Name MRAP2
Accession Number NM_001346544
Gene ID 112609
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 618 bp
Gene Alias bA51G5.2,C6orf117
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCCGCCCAGAGGTTAATTTCTAACAGAACCTCCCAGCAATCGGCATCTAATTCTGATTACACCTGGGAATATGAATATTATGAGATTGGACCAGTTTCCTTTGAAGGACTGAAGGCTCATAAATATTCCATTGTGATTGGATTTTGGGTTGGTCTTGCAGTCTTCGTGATTTTTATGTTTTTTGTGCTGACCTTGCTGACCAAGACAGGAGCCCCACACCAAGACAATGCAGAGTCCTCAGAGAAGAGATTCAGAATGAACAGCTTTGTGTCAGACTTTGGAAGACCTCTGGAGCCAGATAAAGTATTTTCTCGCCAAGGCAACGAGGAGTCCAGGTCTCTCTTTCACTGCTACATCAATGAGGTGGAACGCTTGGACAGAGCCAAAGCTTGTCACCAGACCACAGCCCTTGACAGTGACGTCCAACTCCAGGAAGCCATCAGAAGCAGTGGGCAGCCAGAGGAGGAGCTGAACAGGCTCATGAAGTTTGACATCCCCAACTTTGTGAACACAGACCAGAACTACTTTGGGGAGGATGATCTTCTGATTTCTGAACCACCTATTGTTCTGGAAACTAAGCCACTTTCCCAGACCTCACACAAAGACCTGGATTGA
ORF Protein Sequence MSAQRLISNRTSQQSASNSDYTWEYEYYEIGPVSFEGLKAHKYSIVIGFWVGLAVFVIFMFFVLTLLTKTGAPHQDNAESSEKRFRMNSFVSDFGRPLEPDKVFSRQGNEESRSLFHCYINEVERLDRAKACHQTTALDSDVQLQEAIRSSGQPEEELNRLMKFDIPNFVNTDQNYFGEDDLLISEPPIVLETKPLSQTSHKDLD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0829-Ab Anti-MRAP2/ C6orf117/ bA51G5.2 monoclonal antibody
    Target Antigen GM-Tg-g-MP0829-Ag MRAP2 VLP (virus-like particle)
    ORF Viral Vector pGMLP004128 Human MRAP2 Lentivirus plasmid
    ORF Viral Vector vGMLP004128 Human MRAP2 Lentivirus particle


    Target information

    Target ID GM-MP0829
    Target Name MRAP2
    Gene ID 112609, 244958, 363112, 101083426, 611524, 781188, 100065482
    Gene Symbol and Synonyms bA51G5.2,C6orf117,C9H6ORF117,MRAP2,RGD1309873
    Uniprot Accession Q96G30
    Uniprot Entry Name MRAP2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000135324
    Target Classification Not Available

    This gene encodes a protein that modulates melanocortin receptor signaling. The encoded protein has been shown to interact with all known melanocortin receptors and may regulate both receptor trafficking and activation in response to ligands. Mice lacking a functional copy of this gene exhibit severe obesity and a mutation in this gene may be associated with severe obesity in human patients. [provided by RefSeq, Oct 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.