Human SFRP5/SARP3 ORF/cDNA clone-Lentivirus particle (NM_003015)

Cat. No.: vGMLP004521

Pre-made Human SFRP5/SARP3 Lentiviral expression plasmid for SFRP5 lentivirus packaging, SFRP5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to SFRP5/SARP3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004521 Human SFRP5 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004521
Gene Name SFRP5
Accession Number NM_003015
Gene ID 6425
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 954 bp
Gene Alias SARP3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCGGGCGGCGGCGGCGGGGGGGGGCGTGCGGACGGCCGCGCTGGCGCTGCTGCTGGGGGCGCTGCACTGGGCGCCGGCGCGCTGCGAGGAGTACGACTACTATGGCTGGCAGGCCGAGCCGCTGCACGGCCGCTCCTACTCCAAGCCGCCGCAGTGCCTTGACATCCCTGCCGACCTGCCGCTCTGCCACACGGTGGGCTACAAGCGCATGCGGCTGCCCAACCTGCTGGAGCACGAGAGCCTGGCCGAAGTGAAGCAGCAGGCGAGCAGCTGGCTGCCGCTGCTGGCCAAGCGCTGCCACTCGGATACGCAGGTCTTCCTGTGCTCGCTCTTTGCGCCCGTCTGTCTCGACCGGCCCATCTACCCGTGCCGCTCGCTGTGCGAGGCCGTGCGCGCCGGCTGCGCGCCGCTCATGGAGGCCTACGGCTTCCCCTGGCCTGAGATGCTGCACTGCCACAAGTTCCCCCTGGACAACGACCTCTGCATCGCCGTGCAGTTCGGGCACCTGCCCGCCACCGCGCCTCCAGTGACCAAGATCTGCGCCCAGTGTGAGATGGAGCACAGTGCTGACGGCCTCATGGAGCAGATGTGCTCCAGTGACTTTGTGGTCAAAATGCGCATCAAGGAGATCAAGATAGAGAATGGGGACCGGAAGCTGATTGGAGCCCAGAAAAAGAAGAAGCTGCTCAAGCCGGGCCCCCTGAAGCGCAAGGACACCAAGCGGCTGGTGCTGCACATGAAGAATGGCGCGGGCTGCCCCTGCCCACAGCTGGACAGCCTGGCGGGCAGCTTCCTGGTCATGGGCCGCAAAGTGGATGGACAGCTGCTGCTCATGGCCGTCTACCGCTGGGACAAGAAGAATAAGGAGATGAAGTTTGCAGTCAAATTCATGTTCTCCTACCCCTGCTCCCTCTACTACCCTTTCTTCTACGGGGCGGCAGAGCCCCACTGA
ORF Protein Sequence MRAAAAGGGVRTAALALLLGALHWAPARCEEYDYYGWQAEPLHGRSYSKPPQCLDIPADLPLCHTVGYKRMRLPNLLEHESLAEVKQQASSWLPLLAKRCHSDTQVFLCSLFAPVCLDRPIYPCRSLCEAVRAGCAPLMEAYGFPWPEMLHCHKFPLDNDLCIAVQFGHLPATAPPVTKICAQCEMEHSADGLMEQMCSSDFVVKMRIKEIKIENGDRKLIGAQKKKKLLKPGPLKRKDTKRLVLHMKNGAGCPCPQLDSLAGSFLVMGRKVDGQLLLMAVYRWDKKNKEMKFAVKFMFSYPCSLYYPFFYGAAEPH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1285-Ab Anti-SFRP5/ SARP3 functional antibody
    Target Antigen GM-Tg-g-SE1285-Ag SFRP5 protein
    ORF Viral Vector pGMLP004521 Human SFRP5 Lentivirus plasmid
    ORF Viral Vector vGMLP004521 Human SFRP5 Lentivirus particle


    Target information

    Target ID GM-SE1285
    Target Name SFRP5
    Gene ID 6425, 54612, 707738, 309377, 101088696, 486826, 282069, 100070673
    Gene Symbol and Synonyms SARP3,SFRP5
    Uniprot Accession Q5T4F7
    Uniprot Entry Name SFRP5_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000120057
    Target Classification Tumor-associated antigen (TAA)

    Secreted frizzled-related protein 5 (SFRP5) is a member of the SFRP family that contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins. SFRPs act as soluble modulators of Wnt signaling. SFRP5 and SFRP1 may be involved in determining the polarity of photoreceptor cells in the retina. SFRP5 is highly expressed in the retinal pigment epithelium, and moderately expressed in the pancreas. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.