Human PRRG1/PRGP1 ORF/cDNA clone-Lentivirus particle (NM_000950)

Cat. No.: vGMLP004645

Pre-made Human PRRG1/PRGP1 Lentiviral expression plasmid for PRRG1 lentivirus packaging, PRRG1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to PRRG1/PRGP1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004645 Human PRRG1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004645
Gene Name PRRG1
Accession Number NM_000950
Gene ID 5638
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 657 bp
Gene Alias PRGP1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGAGGGTTTTCCTCACGGGAGAAAAAGCCAATTCCATATTAAAACGCTACCCAAGAGCTAATGGGTTTTTTGAAGAAATAAGACAGGGCAACATTGAGCGTGAGTGCAAAGAAGAATTCTGTACATTTGAAGAAGCAAGAGAAGCTTTTGAAAATAATGAAAAAACTAAGGAGTTTTGGAGCACCTACACAAAAGCGCAACAAGGGGAGAGTAACCGAGGAAGTGACTGGTTTCAGTTTTACCTTACCTTTCCGTTAATCTTTGGCCTCTTCATTATCCTCCTTGTCATTTTCCTAATCTGGAGATGCTTCCTAAGAAACAAAACTCGTAGACAGACAGTGACTGAAGGCCACATTCCTTTCCCTCAGCACCTTAATATTATCACCCCACCCCCCCCACCAGATGAAGTGTTTGACAGCAGTGGATTGTCTCCAGGCTTTCTGGGATATGTAGTTGGGCGCTCAGATTCCGTCTCTACTCGCCTGTCCAATTGTGATCCCCCGCCAACCTATGAGGAAGCCACTGGCCAAGTGAACCTGCAGAGGAGTGAAACAGAACCTCATTTAGACCCACCCCCAGAGTATGAGGACATAGTCAACTCCAACTCAGCCAGTGCCATTCCTATGGTGCCTGTGGTCACCACCATCAAATGA
ORF Protein Sequence MGRVFLTGEKANSILKRYPRANGFFEEIRQGNIERECKEEFCTFEEAREAFENNEKTKEFWSTYTKAQQGESNRGSDWFQFYLTFPLIFGLFIILLVIFLIWRCFLRNKTRRQTVTEGHIPFPQHLNIITPPPPPDEVFDSSGLSPGFLGYVVGRSDSVSTRLSNCDPPPTYEEATGQVNLQRSETEPHLDPPPEYEDIVNSNSASAIPMVPVVTTIK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1409-Ab Anti-TMG1/ PRRG1/ PRGP1 monoclonal antibody
    Target Antigen GM-Tg-g-MP1409-Ag PRRG1 VLP (virus-like particle)
    ORF Viral Vector pGMLP004645 Human PRRG1 Lentivirus plasmid
    ORF Viral Vector vGMLP004645 Human PRRG1 Lentivirus particle


    Target information

    Target ID GM-MP1409
    Target Name PRRG1
    Gene ID 5638, 546336, 696938, 363472, 101085954, 491821, 785916, 100629871
    Gene Symbol and Synonyms 2010007L08Rik,PRGP1,PRRG1,RGD1561320,TMG1
    Uniprot Accession O14668
    Uniprot Entry Name TMG1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000130962
    Target Classification Not Available

    This gene encodes a vitamin K-dependent, gamma-carboxyglutamic acid (Gla)-containing, single-pass transmembrane protein. This protein contains a Gla domain at the N-terminus, preceded by a propeptide sequence required for post-translational gamma-carboxylation of specific glutamic acid residues by a vitamin K-dependent gamma-carboxylase. The C-terminus is proline-rich containing PPXY and PXXP motifs found in a variety of signaling and cytoskeletal proteins. This gene is highly expressed in the spinal cord. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.