Human CLDN19/HOMG5 ORF/cDNA clone-Lentivirus particle (NM_148960)
Cat. No.: vGMLP004709
Pre-made Human CLDN19/HOMG5 Lentiviral expression plasmid for CLDN19 lentivirus packaging, CLDN19 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
CLDN19/HOMG5 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP004709 | Human CLDN19 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP004709 |
| Gene Name | CLDN19 |
| Accession Number | NM_148960 |
| Gene ID | 149461 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 675 bp |
| Gene Alias | HOMG5 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCCAACTCAGGCCTCCAGCTCCTGGGCTACTTCTTGGCCCTGGGTGGCTGGGTGGGCATCATTGCTAGCACAGCCCTGCCACAGTGGAAGCAGTCTTCCTACGCAGGCGACGCCATCATCACTGCCGTGGGCCTCTATGAAGGGCTCTGGATGTCCTGCGCCTCCCAGAGCACTGGGCAAGTGCAGTGCAAGCTCTACGACTCGCTGCTCGCCCTGGACGGTCACATCCAATCAGCGCGGGCCCTGATGGTGGTGGCCGTGCTCCTGGGCTTCGTGGCCATGGTCCTCAGCGTAGTTGGCATGAAGTGTACGCGGGTGGGAGACAGCAACCCCATTGCCAAGGGCCGTGTTGCCATCGCCGGGGGAGCCCTCTTCATCCTGGCAGGCCTCTGCACTTTGACTGCTGTCTCGTGGTATGCCACCCTGGTGACCCAGGAGTTCTTCAACCCAAGCACACCTGTCAATGCCAGGTATGAATTTGGCCCAGCCCTGTTCGTGGGCTGGGCCTCAGCTGGCCTGGCCGTGCTGGGCGGCTCCTTCCTCTGCTGCACATGCCCGGAGCCAGAGAGACCCAACAGCAGCCCACAGCCCTATCGGCCTGGACCCTCTGCTGCTGCCCGAGAACCAGTTGTTAAATTGCCCGCCTCCGCCAAGGGCCCCCTGGGTGTGTAA |
| ORF Protein Sequence | MANSGLQLLGYFLALGGWVGIIASTALPQWKQSSYAGDAIITAVGLYEGLWMSCASQSTGQVQCKLYDSLLALDGHIQSARALMVVAVLLGFVAMVLSVVGMKCTRVGDSNPIAKGRVAIAGGALFILAGLCTLTAVSWYATLVTQEFFNPSTPVNARYEFGPALFVGWASAGLAVLGGSFLCCTCPEPERPNSSPQPYRPGPSAAAREPVVKLPASAKGPLGV |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP0278-Ab | Anti-CLD19/ CLDN19/ HOMG5 monoclonal antibody |
| Target Antigen | GM-Tg-g-MP0278-Ag | CLDN19 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP004709 | Human CLDN19 Lentivirus plasmid |
| ORF Viral Vector | vGMLP004709 | Human CLDN19 Lentivirus particle |
Target information
| Target ID | GM-MP0278 |
| Target Name | CLDN19 |
| Gene ID | 149461, 242653, 697807, 298487, 101093875, 607005, 513034, 100053591 |
| Gene Symbol and Synonyms | claudin-19,CLDN19,HOMG5 |
| Uniprot Accession | Q8N6F1 |
| Uniprot Entry Name | CLD19_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000164007 |
| Target Classification | Not Available |
The product of this gene belongs to the claudin family. It plays a major role in tight junction-specific obliteration of the intercellular space, through calcium-independent cell-adhesion activity. Defects in this gene are the cause of hypomagnesemia renal with ocular involvement (HOMGO). HOMGO is a progressive renal disease characterized by primary renal magnesium wasting with hypomagnesemia, hypercalciuria and nephrocalcinosis associated with severe ocular abnormalities such as bilateral chorioretinal scars, macular colobomata, significant myopia and nystagmus. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


