Human IL31/IL-31 ORF/cDNA clone-Lentivirus particle (NM_001014336)

Pre-made Human IL31/IL-31 Lentiviral expression plasmid for IL31 lentivirus packaging, IL31 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to IL31/IL-31 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004789 Human IL31 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004789
Gene Name IL31
Accession Number NM_001014336
Gene ID 386653
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 495 bp
Gene Alias IL-31
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCTCTCACTCAGGCCCCTCGACGTCTGTGCTCTTTCTGTTCTGCTGCCTGGGAGGCTGGCTGGCCTCCCACACGTTGCCCGTCCGTTTACTACGACCAAGTGATGATGTACAGAAAATAGTCGAGGAATTACAGTCCCTCTCGAAGATGCTTTTGAAAGATGTGGAGGAAGAGAAGGGCGTGCTCGTGTCCCAGAATTACACGCTGCCGTGTCTCAGCCCTGACGCCCAGCCGCCAAACAACATCCACAGCCCAGCCATCCGGGCATATCTCAAGACAATCAGACAGCTAGACAACAAATCTGTTATTGATGAGATCATAGAGCACCTCGACAAACTCATATTTCAAGATGCACCAGAAACAAACATTTCTGTGCCAACAGACACCCATGAATGTAAACGCTTCATCCTGACTATTTCTCAACAGTTTTCAGAGTGCATGGACCTCGCACTAAAATCATTGACCTCTGGAGCCCAACAGGCCACCACTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-319 Pre-Made Lokivetmab biosimilar, Canine Whole Mab: Anti-IL31 therapeutic antibody
    Biosimilar GMP-Bios-ab-155 Pre-Made Dovanvetmab biosimilar, Feline Whole Mab: Anti-IL31 (Feline) therapeutic antibody
    Target Antibody GM-Tg-g-T11701-Ab Anti-IL31/ IL-31 functional antibody
    Target Antigen GM-Tg-g-T11701-Ag IL31 protein
    Cytokine cks-Tg-g-GM-T11701 interleukin 31 (Il31) protein & antibody
    ORF Viral Vector pGMLP004789 Human IL31 Lentivirus plasmid
    ORF Viral Vector pGMLP-IL-035 Human IL31 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-118 Human IL31 Adenovirus plasmid
    ORF Viral Vector vGMLP004789 Human IL31 Lentivirus particle
    ORF Viral Vector vGMLP-IL-035 Human IL31 Lentivirus particle
    ORF Viral Vector vGMAP-IL-118 Human IL31 Adenovirus particle


    Target information

    Target ID GM-T11701
    Target Name IL31
    Gene ID 386653, 76399, 701655, 690028, 105261056, 100302725, 102149194
    Gene Symbol and Synonyms 1700013B14Rik,AABR07036324.1,IL-31,IL31
    Uniprot Accession Q6EBC2
    Uniprot Entry Name IL31_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000204671
    Target Classification Not Available

    IL31, which is made principally by activated Th2-type T cells, interacts with a heterodimeric receptor consisting of IL31RA (MIM 609510) and OSMR (MIM 601743) that is constitutively expressed on epithelial cells and keratinocytes. IL31 may be involved in the promotion of allergic skin disorders and in regulating other allergic diseases, such as asthma (Dillon et al., 2004 [PubMed 15184896]).[supplied by OMIM, Mar 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.