Human IL31/IL-31 ORF/cDNA clone-Lentivirus particle (NM_001014336)
Pre-made Human IL31/IL-31 Lentiviral expression plasmid for IL31 lentivirus packaging, IL31 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to IL31/IL-31 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004789 | Human IL31 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004789 |
Gene Name | IL31 |
Accession Number | NM_001014336 |
Gene ID | 386653 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 495 bp |
Gene Alias | IL-31 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCTCTCACTCAGGCCCCTCGACGTCTGTGCTCTTTCTGTTCTGCTGCCTGGGAGGCTGGCTGGCCTCCCACACGTTGCCCGTCCGTTTACTACGACCAAGTGATGATGTACAGAAAATAGTCGAGGAATTACAGTCCCTCTCGAAGATGCTTTTGAAAGATGTGGAGGAAGAGAAGGGCGTGCTCGTGTCCCAGAATTACACGCTGCCGTGTCTCAGCCCTGACGCCCAGCCGCCAAACAACATCCACAGCCCAGCCATCCGGGCATATCTCAAGACAATCAGACAGCTAGACAACAAATCTGTTATTGATGAGATCATAGAGCACCTCGACAAACTCATATTTCAAGATGCACCAGAAACAAACATTTCTGTGCCAACAGACACCCATGAATGTAAACGCTTCATCCTGACTATTTCTCAACAGTTTTCAGAGTGCATGGACCTCGCACTAAAATCATTGACCTCTGGAGCCCAACAGGCCACCACTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-319 | Pre-Made Lokivetmab biosimilar, Canine Whole Mab: Anti-IL31 therapeutic antibody |
Biosimilar | GMP-Bios-ab-155 | Pre-Made Dovanvetmab biosimilar, Feline Whole Mab: Anti-IL31 (Feline) therapeutic antibody |
Target Antibody | GM-Tg-g-T11701-Ab | Anti-IL31/ IL-31 functional antibody |
Target Antigen | GM-Tg-g-T11701-Ag | IL31 protein |
Cytokine | cks-Tg-g-GM-T11701 | interleukin 31 (Il31) protein & antibody |
ORF Viral Vector | pGMLP004789 | Human IL31 Lentivirus plasmid |
ORF Viral Vector | pGMLP-IL-035 | Human IL31 Lentivirus plasmid |
ORF Viral Vector | pGMAP-IL-118 | Human IL31 Adenovirus plasmid |
ORF Viral Vector | vGMLP004789 | Human IL31 Lentivirus particle |
ORF Viral Vector | vGMLP-IL-035 | Human IL31 Lentivirus particle |
ORF Viral Vector | vGMAP-IL-118 | Human IL31 Adenovirus particle |
Target information
Target ID | GM-T11701 |
Target Name | IL31 |
Gene ID | 386653, 76399, 701655, 690028, 105261056, 100302725, 102149194 |
Gene Symbol and Synonyms | 1700013B14Rik,AABR07036324.1,IL-31,IL31 |
Uniprot Accession | Q6EBC2 |
Uniprot Entry Name | IL31_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, INN Index, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000204671 |
Target Classification | Not Available |
IL31, which is made principally by activated Th2-type T cells, interacts with a heterodimeric receptor consisting of IL31RA (MIM 609510) and OSMR (MIM 601743) that is constitutively expressed on epithelial cells and keratinocytes. IL31 may be involved in the promotion of allergic skin disorders and in regulating other allergic diseases, such as asthma (Dillon et al., 2004 [PubMed 15184896]).[supplied by OMIM, Mar 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.