Human Icmt/HSTE14/MST098 ORF/cDNA clone-Lentivirus particle (NM_012405)
Cat. No.: vGMLP004943
Pre-made Human Icmt/HSTE14/MST098 Lentiviral expression plasmid for Icmt lentivirus packaging, Icmt lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
ICMT/Icmt/HSTE14 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP004943 | Human Icmt Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP004943 |
| Gene Name | Icmt |
| Accession Number | NM_012405 |
| Gene ID | 23463 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 855 bp |
| Gene Alias | HSTE14,MST098,MSTP098,PCCMT,PCMT,PPMT |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCGGGCTGCGCGGCGCGGGCTCCGCCGGGCTCTGAGGCGCGTCTCAGCCTCGCCACCTTCCTGCTGGGCGCCTCGGTGCTCGCGCTGCCGCTGCTCACGCGCGCCGGCCTGCAGGGCCGCACCGGGCTGGCGCTCTACGTGGCCGGGCTCAACGCGCTGCTGCTGCTGCTCTATCGGCCGCCTCGCTACCAGATAGCCATCCGAGCTTGTTTCCTGGGGTTTGTGTTCGGCTGCGGCACGCTGCTAAGTTTTAGCCAGTCTTCTTGGAGTCACTTTGGCTGGTACATGTGCTCCCTGTCATTGTTCCACTATTCTGAATACTTGGTGACAGCAGTCAATAATCCCAAAAGTCTGTCCTTGGATTCCTTTCTCCTGAATCACAGCCTGGAGTATACAGTAGCTGCTCTTTCTTCTTGGTTAGAGTTCACACTTGAAAATATCTTTTGGCCAGAACTGAAGCAGATTACCTGGCTCAGTGTCACAGGGCTGCTGATGGTGGTCTTCGGAGAATGTCTGAGGAAGGCGGCCATGTTTACAGCTGGCTCCAATTTCAACCACGTGGTACAGAATGAAAAATCAGATACACATACTCTGGTGACCAGTGGAGTGTACGCTTGGTTTCGGCATCCTTCTTACGTCGGGTGGTTTTACTGGAGTATTGGAACTCAGGTGATGCTGTGTAACCCCATCTGCGGCGTCAGCTATGCCCTGACAGTGTGGCGATTCTTCCGCGATCGAACAGAAGAAGAAGAAATCTCACTAATTCACTTTTTTGGAGAGGAGTACCTGGAGTATAAGAAGAGGGTGCCCACGGGCCTGCCTTTCATAAAGGGGGTCAAGGTGGACCTGTGA |
| ORF Protein Sequence | MAGCAARAPPGSEARLSLATFLLGASVLALPLLTRAGLQGRTGLALYVAGLNALLLLLYRPPRYQIAIRACFLGFVFGCGTLLSFSQSSWSHFGWYMCSLSLFHYSEYLVTAVNNPKSLSLDSFLLNHSLEYTVAALSSWLEFTLENIFWPELKQITWLSVTGLLMVVFGECLRKAAMFTAGSNFNHVVQNEKSDTHTLVTSGVYAWFRHPSYVGWFYWSIGTQVMLCNPICGVSYALTVWRFFRDRTEEEEISLIHFFGEEYLEYKKRVPTGLPFIKGVKVDL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-IP0994-Ab | Anti-ICMT monoclonal antibody |
| Target Antigen | GM-Tg-g-IP0994-Ag | ICMT protein |
| ORF Viral Vector | pGMLP004943 | Human Icmt Lentivirus plasmid |
| ORF Viral Vector | pGMLP005585 | Human ICMT Lentivirus plasmid |
| ORF Viral Vector | vGMLP004943 | Human Icmt Lentivirus particle |
| ORF Viral Vector | vGMLP005585 | Human ICMT Lentivirus particle |
Target information
| Target ID | GM-IP0994 |
| Target Name | ICMT |
| Gene ID | 23463, 57295, 702925, 170818, 101093374, 489628, 785548, 100059680 |
| Gene Symbol and Synonyms | 1700008E11Rik,fcmt,Gm13095,HSTE14,ICMT,MST098,MSTP098,PCCMT,PCMT,PPMT,STE14 |
| Uniprot Accession | O60725 |
| Uniprot Entry Name | ICMT_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000116237 |
| Target Classification | Not Available |
This gene encodes the third of three enzymes that posttranslationally modify isoprenylated C-terminal cysteine residues in certain proteins and target those proteins to the cell membrane. This enzyme localizes to the endoplasmic reticulum. Alternative splicing may result in other transcript variants, but the biological validity of those transcripts has not been determined. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


