Human ICMT/HSTE14/MST098 ORF/cDNA clone-Lentivirus particle (NM_012405.3)

Cat. No.: vGMLP005585

Pre-made Human ICMT/HSTE14/MST098 Lentiviral expression plasmid for ICMT lentivirus packaging, ICMT lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to ICMT/HSTE14 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005585 Human ICMT Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005585
Gene Name ICMT
Accession Number NM_012405.3
Gene ID 23463
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 855 bp
Gene Alias HSTE14,MST098,MSTP098,PCCMT,PCMT,PPMT
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGGCTGCGCGGCGCGGGCTCCGCCGGGCTCTGAGGCGCGTCTCAGCCTCGCCACCTTCCTGCTGGGCGCCTCGGTGCTCGCGCTGCCGCTGCTCACGCGCGCCGGCCTGCAGGGCCGCACCGGGCTGGCGCTCTACGTGGCCGGGCTCAACGCGCTGCTGCTGCTGCTCTATCGGCCGCCTCGCTACCAGATAGCCATCCGAGCTTGTTTCCTGGGGTTTGTGTTCGGCTGCGGCACGCTGCTAAGTTTTAGCCAGTCTTCTTGGAGTCACTTTGGCTGGTACATGTGCTCCCTGTCATTGTTCCACTATTCTGAATACTTGGTGACAGCAGTCAATAATCCCAAAAGTCTGTCCTTGGATTCCTTTCTCCTGAATCACAGCCTGGAGTATACAGTAGCTGCTCTTTCTTCTTGGTTAGAGTTCACACTTGAAAATATCTTTTGGCCAGAACTGAAGCAGATTACCTGGCTCAGTGTCACAGGGCTGCTGATGGTGGTCTTCGGAGAATGTCTGAGGAAGGCGGCCATGTTTACAGCTGGCTCCAATTTCAACCACGTGGTACAGAATGAAAAATCAGATACACATACTCTGGTGACCAGTGGAGTGTACGCTTGGTTTCGGCATCCTTCTTACGTCGGGTGGTTTTACTGGAGTATTGGAACTCAGGTGATGCTGTGTAACCCCATCTGCGGCGTCAGCTATGCCCTGACAGTGTGGCGATTCTTCCGCGATCGAACAGAAGAAGAAGAAATCTCACTAATTCACTTTTTTGGAGAGGAGTACCTGGAGTATAAGAAGAGGGTGCCCACGGGCCTGCCTTTCATAAAGGGGGTCAAGGTGGACCTGTGA
ORF Protein Sequence MAGCAARAPPGSEARLSLATFLLGASVLALPLLTRAGLQGRTGLALYVAGLNALLLLLYRPPRYQIAIRACFLGFVFGCGTLLSFSQSSWSHFGWYMCSLSLFHYSEYLVTAVNNPKSLSLDSFLLNHSLEYTVAALSSWLEFTLENIFWPELKQITWLSVTGLLMVVFGECLRKAAMFTAGSNFNHVVQNEKSDTHTLVTSGVYAWFRHPSYVGWFYWSIGTQVMLCNPICGVSYALTVWRFFRDRTEEEEISLIHFFGEEYLEYKKRVPTGLPFIKGVKVDL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0994-Ab Anti-ICMT monoclonal antibody
    Target Antigen GM-Tg-g-IP0994-Ag ICMT protein
    ORF Viral Vector pGMLP004943 Human Icmt Lentivirus plasmid
    ORF Viral Vector pGMLP005585 Human ICMT Lentivirus plasmid
    ORF Viral Vector vGMLP004943 Human Icmt Lentivirus particle
    ORF Viral Vector vGMLP005585 Human ICMT Lentivirus particle


    Target information

    Target ID GM-IP0994
    Target Name ICMT
    Gene ID 23463, 57295, 702925, 170818, 101093374, 489628, 785548, 100059680
    Gene Symbol and Synonyms 1700008E11Rik,fcmt,Gm13095,HSTE14,ICMT,MST098,MSTP098,PCCMT,PCMT,PPMT,STE14
    Uniprot Accession O60725
    Uniprot Entry Name ICMT_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000116237
    Target Classification Not Available

    This gene encodes the third of three enzymes that posttranslationally modify isoprenylated C-terminal cysteine residues in certain proteins and target those proteins to the cell membrane. This enzyme localizes to the endoplasmic reticulum. Alternative splicing may result in other transcript variants, but the biological validity of those transcripts has not been determined. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.