Human NIPA1/FSP3/SLC57A1 ORF/cDNA clone-Lentivirus particle (NM_144599)

Cat. No.: vGMLP004947

Pre-made Human NIPA1/FSP3/SLC57A1 Lentiviral expression plasmid for NIPA1 lentivirus packaging, NIPA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to NIPA1/FSP3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004947 Human NIPA1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004947
Gene Name NIPA1
Accession Number NM_144599
Gene ID 123606
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 990 bp
Gene Alias FSP3,SLC57A1,SPG6
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGACTGCAGCTGCGGCAGCGGCGGCGGCGGCGGCGGCGGCGGCCGGGGAGGGGGCGCGTAGCCCGAGCCCCGCCGCCGTGTCGCTCGGCCTGGGCGTGGCCGTCGTGTCGAGCCTGGTGAACGGGTCCACGTTCGTGCTACAGAAGAAGGGCATCGTGCGTGCCAAGCGGCGAGGTACTTCCTATTTAACAGACATTGTGTGGTGGGCTGGCACAATCGCAATGGCTGTTGGCCAGATTGGAAACTTCCTGGCTTACACGGCGGTCCCCACGGTCCTGGTAACCCCCCTGGGCGCCCTTGGAGTACCGTTCGGGTCCATTTTAGCTTCCTATCTCCTGAAGGAAAAGCTCAACATCTTGGGCAAGTTGGGGTGCCTGCTAAGCTGTGCAGGCTCCGTCGTGCTGATTATCCACTCCCCAAAGTCTGAGAGTGTGACAACTCAGGCTGAGCTGGAGGAAAAGCTGACCAATCCAGTGTTTGTGGGCTACCTGTGCATCGTGCTGCTCATGCTGCTGCTGCTCATCTTCTGGATCGCGCCGGCCCATGGGCCCACCAACATCATGGTCTACATCAGCATCTGCTCCTTGCTGGGCAGTTTCACCGTGCCTTCCACCAAGGGCATCGGGCTGGCGGCCCAAGACATCTTGCATAACAACCCGTCCAGTCAGAGAGCCCTCTGCCTGTGCCTGGTACTCCTGGCCGTGCTCGGCTGCAGCATCATCGTCCAGTTCAGGTACATCAACAAGGCGCTGGAGTGCTTCGACTCCTCGGTGTTCGGGGCCATCTACTACGTCGTGTTTACCACGCTGGTCCTGCTGGCCTCAGCCATCCTCTTCCGGGAGTGGAGCAACGTGGGCCTGGTGGACTTCTTGGGGATGGCCTGTGGATTCACGACCGTCTCCGTGGGGATTGTCCTTATACAGGTGTTCAAAGAGTTCAATTTCAACCTTGGGGAGATGAACAAATCTAATATGAAAACAGACTAG
ORF Protein Sequence MGTAAAAAAAAAAAAAGEGARSPSPAAVSLGLGVAVVSSLVNGSTFVLQKKGIVRAKRRGTSYLTDIVWWAGTIAMAVGQIGNFLAYTAVPTVLVTPLGALGVPFGSILASYLLKEKLNILGKLGCLLSCAGSVVLIIHSPKSESVTTQAELEEKLTNPVFVGYLCIVLLMLLLLIFWIAPAHGPTNIMVYISICSLLGSFTVPSTKGIGLAAQDILHNNPSSQRALCLCLVLLAVLGCSIIVQFRYINKALECFDSSVFGAIYYVVFTTLVLLASAILFREWSNVGLVDFLGMACGFTTVSVGIVLIQVFKEFNFNLGEMNKSNMKTD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0878-Ab Anti-NIPA1/ FSP3/ SLC57A1 monoclonal antibody
    Target Antigen GM-Tg-g-MP0878-Ag NIPA1 VLP (virus-like particle)
    ORF Viral Vector pGMLP004947 Human NIPA1 Lentivirus plasmid
    ORF Viral Vector vGMLP004947 Human NIPA1 Lentivirus particle


    Target information

    Target ID GM-MP0878
    Target Name NIPA1
    Gene ID 123606, 233280, 710236, 308668, 101090753, 488681, 539162, 100146592
    Gene Symbol and Synonyms 1110027G09Rik,A830014A18Rik,FSP3,NIPA1,SLC56A1,SLC57A1,SPG6
    Uniprot Accession Q7RTP0
    Uniprot Entry Name NIPA1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000170113
    Target Classification Not Available

    This gene encodes a magnesium transporter that associates with early endosomes and the cell surface in a variety of neuronal and epithelial cells. This protein may play a role in nervous system development and maintenance. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene have been associated with autosomal dominant spastic paraplegia 6. [provided by RefSeq, Nov 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.