Human CD1A/CD1/ FCB6 ORF/cDNA clone-Lentivirus particle (NM_001763)
Pre-made Human CD1A/CD1/ FCB6 Lentiviral expression plasmid for CD1A lentivirus packaging, CD1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CD1A/CD1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004956 | Human CD1A Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004956 |
Gene Name | CD1A |
Accession Number | NM_001763 |
Gene ID | 909 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 984 bp |
Gene Alias | CD1, FCB6, HTA1, R4, T6 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCTGTTTTTGCTACTTCCATTGTTAGCTGTTCTCCCAGGTGATGGCAATGCAGACGGGCTCAAGGAGCCTCTCTCCTTCCATGTCACCTGGATCGCATCCTTTTACAACCATTCCTGGAAACAAAATCTGGTCTCAGGTTGGCTGAGTGATTTGCAGACTCATACCTGGGACAGCAATTCCAGCACCATCGTTTTCCTGTGCCCCTGGTCCAGGGGAAACTTCAGCAATGAGGAGTGGAAGGAACTGGAAACATTATTCCGTATACGCACCATTCGGTCATTTGAGGGAATTCGTAGATACGCCCATGAATTGCAGTTTGAATATCCTTTTGAGATACAGGTGACAGGAGGCTGTGAGCTGCACTCTGGAAAGGTCTCAGGAAGCTTCTTGCAGTTAGCTTATCAAGGATCAGACTTTGTGAGCTTCCAGAACAATTCATGGTTGCCATATCCAGTGGCTGGGAATATGGCCAAGCATTTCTGCAAAGTGCTCAATCAGAATCAGCATGAAAATGACATAACACACAATCTTCTCAGTGACACCTGCCCACGTTTCATCTTGGGTCTTCTTGATGCAGGAAAGGCACATCTCCAGCGGCAAGTGAAGCCCGAGGCCTGGCTGTCCCATGGCCCCAGTCCTGGCCCTGGCCATCTGCAGCTTGTGTGCCATGTCTCAGGATTCTACCCAAAGCCCGTGTGGGTGATGTGGATGCGGGGTGAGCAGGAGCAGCAGGGCACTCAGCGAGGGGACATCTTGCCCAGTGCTGATGGGACATGGTATCTCCGCGCAACCCTGGAGGTGGCCGCTGGGGAGGCAGCTGACCTGTCCTGTCGGGTGAAGCACAGCAGTCTAGAGGGCCAGGACATCGTCCTCTACTGGGAGCATCACAGTTCCGTGGGCTTCATCATCTTGGCGGTGATAGTGCCTTTACTTCTTCTGATAGGTCTTGCGCTTTGGTTCAGGAAACGCTGTTTCTGTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T60433-Ab | Anti-CD1A/ CD1/ FCB6 monoclonal antibody |
Target Antigen | GM-Tg-g-T60433-Ag | CD1A VLP (virus-like particle) |
ORF Viral Vector | pGMLP004956 | Human CD1A Lentivirus plasmid |
ORF Viral Vector | vGMLP004956 | Human CD1A Lentivirus particle |
Target information
Target ID | GM-T60433 |
Target Name | CD1A |
Gene ID | 909, 698438 |
Gene Symbol and Synonyms | CD1,CD1A,FCB6,HTA1,R4,T6 |
Uniprot Accession | P06126 |
Uniprot Entry Name | CD1A_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target |
Disease | Breast Cancer |
Gene Ensembl | ENSG00000158477 |
Target Classification | Checkpoint-Immuno Oncology |
This gene encodes a member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene localizes to the plasma membrane and to recycling vesicles of the early endocytic system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.