Human CD1A/CD1/ FCB6 ORF/cDNA clone-Lentivirus particle (NM_001763)

Pre-made Human CD1A/CD1/ FCB6 Lentiviral expression plasmid for CD1A lentivirus packaging, CD1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CD1A/CD1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004956 Human CD1A Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004956
Gene Name CD1A
Accession Number NM_001763
Gene ID 909
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 984 bp
Gene Alias CD1, FCB6, HTA1, R4, T6
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTGTTTTTGCTACTTCCATTGTTAGCTGTTCTCCCAGGTGATGGCAATGCAGACGGGCTCAAGGAGCCTCTCTCCTTCCATGTCACCTGGATCGCATCCTTTTACAACCATTCCTGGAAACAAAATCTGGTCTCAGGTTGGCTGAGTGATTTGCAGACTCATACCTGGGACAGCAATTCCAGCACCATCGTTTTCCTGTGCCCCTGGTCCAGGGGAAACTTCAGCAATGAGGAGTGGAAGGAACTGGAAACATTATTCCGTATACGCACCATTCGGTCATTTGAGGGAATTCGTAGATACGCCCATGAATTGCAGTTTGAATATCCTTTTGAGATACAGGTGACAGGAGGCTGTGAGCTGCACTCTGGAAAGGTCTCAGGAAGCTTCTTGCAGTTAGCTTATCAAGGATCAGACTTTGTGAGCTTCCAGAACAATTCATGGTTGCCATATCCAGTGGCTGGGAATATGGCCAAGCATTTCTGCAAAGTGCTCAATCAGAATCAGCATGAAAATGACATAACACACAATCTTCTCAGTGACACCTGCCCACGTTTCATCTTGGGTCTTCTTGATGCAGGAAAGGCACATCTCCAGCGGCAAGTGAAGCCCGAGGCCTGGCTGTCCCATGGCCCCAGTCCTGGCCCTGGCCATCTGCAGCTTGTGTGCCATGTCTCAGGATTCTACCCAAAGCCCGTGTGGGTGATGTGGATGCGGGGTGAGCAGGAGCAGCAGGGCACTCAGCGAGGGGACATCTTGCCCAGTGCTGATGGGACATGGTATCTCCGCGCAACCCTGGAGGTGGCCGCTGGGGAGGCAGCTGACCTGTCCTGTCGGGTGAAGCACAGCAGTCTAGAGGGCCAGGACATCGTCCTCTACTGGGAGCATCACAGTTCCGTGGGCTTCATCATCTTGGCGGTGATAGTGCCTTTACTTCTTCTGATAGGTCTTGCGCTTTGGTTCAGGAAACGCTGTTTCTGTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T60433-Ab Anti-CD1A/ CD1/ FCB6 monoclonal antibody
    Target Antigen GM-Tg-g-T60433-Ag CD1A VLP (virus-like particle)
    ORF Viral Vector pGMLP004956 Human CD1A Lentivirus plasmid
    ORF Viral Vector vGMLP004956 Human CD1A Lentivirus particle


    Target information

    Target ID GM-T60433
    Target Name CD1A
    Gene ID 909, 698438
    Gene Symbol and Synonyms CD1,CD1A,FCB6,HTA1,R4,T6
    Uniprot Accession P06126
    Uniprot Entry Name CD1A_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Breast Cancer
    Gene Ensembl ENSG00000158477
    Target Classification Checkpoint-Immuno Oncology

    This gene encodes a member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene localizes to the plasma membrane and to recycling vesicles of the early endocytic system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.