Human ACVR2B/ActR-IIB/ACTRIIB ORF/cDNA clone-Lentivirus particle (NM_001106.3)

Cat. No.: vGMLP005214

Pre-made Human ACVR2B/ActR-IIB/ACTRIIB Lentiviral expression plasmid for ACVR2B lentivirus packaging, ACVR2B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to ACVR2B/ActR-IIB products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005214 Human ACVR2B Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005214
Gene Name ACVR2B
Accession Number NM_001106.3
Gene ID 93
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1539 bp
Gene Alias ActR-IIB,ACTRIIB,HTX4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACGGCGCCCTGGGTGGCCCTCGCCCTCCTCTGGGGATCGCTGTGCGCCGGCTCTGGGCGTGGGGAGGCTGAGACACGGGAGTGCATCTACTACAACGCCAACTGGGAGCTGGAGCGCACCAACCAGAGCGGCCTGGAGCGCTGCGAAGGCGAGCAGGACAAGCGGCTGCACTGCTACGCCTCCTGGCGCAACAGCTCTGGCACCATCGAGCTCGTGAAGAAGGGCTGCTGGCTAGATGACTTCAACTGCTACGATAGGCAGGAGTGTGTGGCCACTGAGGAGAACCCCCAGGTGTACTTCTGCTGCTGTGAAGGCAACTTCTGCAACGAACGCTTCACTCATTTGCCAGAGGCTGGGGGCCCGGAAGTCACGTACGAGCCACCCCCGACAGCCCCCACCCTGCTCACGGTGCTGGCCTACTCACTGCTGCCCATCGGGGGCCTTTCCCTCATCGTCCTGCTGGCCTTTTGGATGTACCGGCATCGCAAGCCCCCCTACGGTCATGTGGACATCCATGAGGACCCTGGGCCTCCACCACCATCCCCTCTGGTGGGCCTGAAGCCACTGCAGCTGCTGGAGATCAAGGCTCGGGGGCGCTTTGGCTGTGTCTGGAAGGCCCAGCTCATGAATGACTTTGTAGCTGTCAAGATCTTCCCACTCCAGGACAAGCAGTCGTGGCAGAGTGAACGGGAGATCTTCAGCACACCTGGCATGAAGCACGAGAACCTGCTACAGTTCATTGCTGCCGAGAAGCGAGGCTCCAACCTCGAAGTAGAGCTGTGGCTCATCACGGCCTTCCATGACAAGGGCTCCCTCACGGATTACCTCAAGGGGAACATCATCACATGGAACGAACTGTGTCATGTAGCAGAGACGATGTCACGAGGCCTCTCATACCTGCATGAGGATGTGCCCTGGTGCCGTGGCGAGGGCCACAAGCCGTCTATTGCCCACAGGGACTTTAAAAGTAAGAATGTATTGCTGAAGAGCGACCTCACAGCCGTGCTGGCTGACTTTGGCTTGGCTGTTCGATTTGAGCCAGGGAAACCTCCAGGGGACACCCACGGACAGGTAGGCACGAGACGGTACATGGCTCCTGAGGTGCTCGAGGGAGCCATCAACTTCCAGAGAGATGCCTTCCTGCGCATTGACATGTATGCCATGGGGTTGGTGCTGTGGGAGCTTGTGTCTCGCTGCAAGGCTGCAGACGGACCCGTGGATGAGTACATGCTGCCCTTTGAGGAAGAGATTGGCCAGCACCCTTCGTTGGAGGAGCTGCAGGAGGTGGTGGTGCACAAGAAGATGAGGCCCACCATTAAAGATCACTGGTTGAAACACCCGGGCCTGGCCCAGCTTTGTGTGACCATCGAGGAGTGCTGGGACCATGATGCAGAGGCTCGCTTGTCCGCGGGCTGTGTGGAGGAGCGGGTGTCCCTGATTCGGAGGTCGGTCAACGGCACTACCTCGGACTGTCTCGTTTCCCTGGTGACCTCTGTCACCAATGTGGACCTGCCCCCTAAAGAGTCAAGCATCTAA
ORF Protein Sequence MTAPWVALALLWGSLCAGSGRGEAETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWRNSSGTIELVKKGCWLDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPEAGGPEVTYEPPPTAPTLLTVLAYSLLPIGGLSLIVLLAFWMYRHRKPPYGHVDIHEDPGPPPPSPLVGLKPLQLLEIKARGRFGCVWKAQLMNDFVAVKIFPLQDKQSWQSEREIFSTPGMKHENLLQFIAAEKRGSNLEVELWLITAFHDKGSLTDYLKGNIITWNELCHVAETMSRGLSYLHEDVPWCRGEGHKPSIAHRDFKSKNVLLKSDLTAVLADFGLAVRFEPGKPPGDTHGQVGTRRYMAPEVLEGAINFQRDAFLRIDMYAMGLVLWELVSRCKAADGPVDEYMLPFEEEIGQHPSLEELQEVVVHKKMRPTIKDHWLKHPGLAQLCVTIEECWDHDAEARLSAGCVEERVSLIRRSVNGTTSDCLVSLVTSVTNVDLPPKESSI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-069 Pre-Made Bimagrumab biosimilar, Whole mAb, Anti-ACVR2B Antibody: Anti-ACTRIIB/ActR-IIB/HTX4 therapeutic antibody
    Target Antibody GM-Tg-g-T80338-Ab Anti-AVR2B/ ACVR2B/ ACTRIIB monoclonal antibody
    Target Antigen GM-Tg-g-T80338-Ag ACVR2B VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T80338 activin A receptor, type IIB (ACVR2B) protein & antibody
    ORF Viral Vector pGMLP005214 Human ACVR2B Lentivirus plasmid
    ORF Viral Vector vGMLP005214 Human ACVR2B Lentivirus particle


    Target information

    Target ID GM-T80338
    Target Name ACVR2B
    Gene ID 93, 11481, 696071, 25366, 101086087, 485590, 282131, 100053588
    Gene Symbol and Synonyms 4930516B21Rik,ActR-IIB,ACTRIIB,ACVR2B,AI047905,HTX4
    Uniprot Accession Q13705
    Uniprot Entry Name AVR2B_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000114739
    Target Classification Kinase

    Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I (I and IB) and two type II (II and IIB) receptors. These receptors are all transmembrane proteins, composed of a ligand-binding extracellular domain with cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine specificity. Type I receptors are essential for signaling; and type II receptors are required for binding ligands and for expression of type I receptors. Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors. Type II receptors are considered to be constitutively active kinases. This gene encodes activin A type IIB receptor, which displays a 3- to 4-fold higher affinity for the ligand than activin A type II receptor. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.