Human AURKB/AIK2/AIM-1 ORF/cDNA clone-Lentivirus particle (NM_001313950.1)

Cat. No.: vGMLP005299

Pre-made Human AURKB/AIK2/AIM-1 Lentiviral expression plasmid for AURKB lentivirus packaging, AURKB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to AURKB/AIK2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005299 Human AURKB Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005299
Gene Name AURKB
Accession Number NM_001313950.1
Gene ID 9212
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1035 bp
Gene Alias AIK2,AIM-1,AIM1,ARK-2,ARK2,AurB,aurkb-sv1,aurkb-sv2,IPL1,PPP1R48,STK-1,STK12,STK5
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCCAGAAGGAGAACTCCTACCCCTGGCCCTACGGCCGACAGACGGCTCCATCTGGCCTGAGCACCCTGCCCCAGCGAGTCCTCCGGAAAGAGCCTGTCACCCCATCTGCACTTGTCCTCATGAGCCGCTCCAATGTCCAGCCCACAGCTGCCCCTGGCCAGAAGGTGATGGAGAATAGCAGTGGGACACCCGACATCTTAACGCGGCACTTCACAATTGATGACTTTGAGATTGGGCGTCCTCTGGGCAAAGGCAAGTTTGGAAACGTGTACTTGGCTCGGGAGAAGAAAAGCCATTTCATCGTGGCGCTCAAGGTCCTCTTCAAGTCCCAGATAGAGAAGGAGGGCGTGGAGCATCAGCTGCGCAGAGAGATCGAAATCCAGGCCCACCTGCACCATCCCAACATCCTGCGTCTCTACAACTATTTTTATGACCGGAGGAGGATCTACTTGATTCTAGAGTATGCCCCCCGCGGGGAGCTCTACAAGGAGCTGCAGAAGAGCTGCACATTTGACGAGCAGCGAACAGCCACGATCATGGAGGAGTTGGCAGATGCTCTAATGTACTGCCATGGGAAGAAGGTGATTCACAGAGACATAAAGCCAGAAAATCTGCTCTTAGGGCTCAAGGGAGAGCTGAAGATTGCTGACTTCGGCTGGTCTGTGCATGCGCCCTCCCTGAGGAGGAAGACAATGTGTGGCACCCTGGACTACCTGCCCCCAGAGATGATTGAGGGGCGCATGCACAATGAGAAGGTGGATCTGTGGTGCATTGGAGTGCTTTGCTATGAGCTGCTGGTGGGGAACCCACCCTTTGAGAGTGCATCACACAACGAGACCTATCGCCGCATCGTCAAGGTGGACCTAAAGTTCCCCGCTTCCGTGCCCATGGGAGCCCAGGACCTCATCTCCAAACTGCTCAGGCATAACCCCTCGGAACGGCTGCCCCTGGCCCAGGTCTCAGCCCACCCTTGGGTCCGGGCCAACTCTCGGAGGGTGCTGCCTCCCTCTGCCCTTCAATCTGTCGCCTGA
ORF Protein Sequence MAQKENSYPWPYGRQTAPSGLSTLPQRVLRKEPVTPSALVLMSRSNVQPTAAPGQKVMENSSGTPDILTRHFTIDDFEIGRPLGKGKFGNVYLAREKKSHFIVALKVLFKSQIEKEGVEHQLRREIEIQAHLHHPNILRLYNYFYDRRRIYLILEYAPRGELYKELQKSCTFDEQRTATIMEELADALMYCHGKKVIHRDIKPENLLLGLKGELKIADFGWSVHAPSLRRKTMCGTLDYLPPEMIEGRMHNEKVDLWCIGVLCYELLVGNPPFESASHNETYRRIVKVDLKFPASVPMGAQDLISKLLRHNPSERLPLAQVSAHPWVRANSRRVLPPSALQSVA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T46781-Ab Anti-AURKB monoclonal antibody
    Target Antigen GM-Tg-g-T46781-Ag AURKB protein
    ORF Viral Vector pGMLP005299 Human AURKB Lentivirus plasmid
    ORF Viral Vector pGMPC000527 Human AURKB Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP005299 Human AURKB Lentivirus particle


    Target information

    Target ID GM-T46781
    Target Name AURKB
    Gene ID 9212, 20877, 721955, 114592, 101081264, 479492, 360192, 100073050
    Gene Symbol and Synonyms AIK2,AIM-1,AIM1,AIRK2,ARK-2,ARK2,AurB,AURKB,aurkb-sv1,aurkb-sv2,IPL1,PPP1R48,STK-1,STK12,STK5
    Uniprot Accession Q96GD4
    Uniprot Entry Name AURKB_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000178999
    Target Classification Kinase, Tumor-associated antigen (TAA)

    This gene encodes a member of the aurora kinase subfamily of serine/threonine kinases. The genes encoding the other two members of this subfamily are located on chromosomes 19 and 20. These kinases participate in the regulation of alignment and segregation of chromosomes during mitosis and meiosis through association with microtubules. A pseudogene of this gene is located on chromosome 8. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.