Human AURKB/AIK2/AIM-1 ORF/cDNA clone-Lentivirus particle (NM_001313950.1)
Cat. No.: vGMLP005299
Pre-made Human AURKB/AIK2/AIM-1 Lentiviral expression plasmid for AURKB lentivirus packaging, AURKB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
AURKB/AIK2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP005299 | Human AURKB Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP005299 |
Gene Name | AURKB |
Accession Number | NM_001313950.1 |
Gene ID | 9212 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1035 bp |
Gene Alias | AIK2,AIM-1,AIM1,ARK-2,ARK2,AurB,aurkb-sv1,aurkb-sv2,IPL1,PPP1R48,STK-1,STK12,STK5 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCCCAGAAGGAGAACTCCTACCCCTGGCCCTACGGCCGACAGACGGCTCCATCTGGCCTGAGCACCCTGCCCCAGCGAGTCCTCCGGAAAGAGCCTGTCACCCCATCTGCACTTGTCCTCATGAGCCGCTCCAATGTCCAGCCCACAGCTGCCCCTGGCCAGAAGGTGATGGAGAATAGCAGTGGGACACCCGACATCTTAACGCGGCACTTCACAATTGATGACTTTGAGATTGGGCGTCCTCTGGGCAAAGGCAAGTTTGGAAACGTGTACTTGGCTCGGGAGAAGAAAAGCCATTTCATCGTGGCGCTCAAGGTCCTCTTCAAGTCCCAGATAGAGAAGGAGGGCGTGGAGCATCAGCTGCGCAGAGAGATCGAAATCCAGGCCCACCTGCACCATCCCAACATCCTGCGTCTCTACAACTATTTTTATGACCGGAGGAGGATCTACTTGATTCTAGAGTATGCCCCCCGCGGGGAGCTCTACAAGGAGCTGCAGAAGAGCTGCACATTTGACGAGCAGCGAACAGCCACGATCATGGAGGAGTTGGCAGATGCTCTAATGTACTGCCATGGGAAGAAGGTGATTCACAGAGACATAAAGCCAGAAAATCTGCTCTTAGGGCTCAAGGGAGAGCTGAAGATTGCTGACTTCGGCTGGTCTGTGCATGCGCCCTCCCTGAGGAGGAAGACAATGTGTGGCACCCTGGACTACCTGCCCCCAGAGATGATTGAGGGGCGCATGCACAATGAGAAGGTGGATCTGTGGTGCATTGGAGTGCTTTGCTATGAGCTGCTGGTGGGGAACCCACCCTTTGAGAGTGCATCACACAACGAGACCTATCGCCGCATCGTCAAGGTGGACCTAAAGTTCCCCGCTTCCGTGCCCATGGGAGCCCAGGACCTCATCTCCAAACTGCTCAGGCATAACCCCTCGGAACGGCTGCCCCTGGCCCAGGTCTCAGCCCACCCTTGGGTCCGGGCCAACTCTCGGAGGGTGCTGCCTCCCTCTGCCCTTCAATCTGTCGCCTGA |
ORF Protein Sequence | MAQKENSYPWPYGRQTAPSGLSTLPQRVLRKEPVTPSALVLMSRSNVQPTAAPGQKVMENSSGTPDILTRHFTIDDFEIGRPLGKGKFGNVYLAREKKSHFIVALKVLFKSQIEKEGVEHQLRREIEIQAHLHHPNILRLYNYFYDRRRIYLILEYAPRGELYKELQKSCTFDEQRTATIMEELADALMYCHGKKVIHRDIKPENLLLGLKGELKIADFGWSVHAPSLRRKTMCGTLDYLPPEMIEGRMHNEKVDLWCIGVLCYELLVGNPPFESASHNETYRRIVKVDLKFPASVPMGAQDLISKLLRHNPSERLPLAQVSAHPWVRANSRRVLPPSALQSVA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T46781-Ab | Anti-AURKB monoclonal antibody |
Target Antigen | GM-Tg-g-T46781-Ag | AURKB protein |
ORF Viral Vector | pGMLP005299 | Human AURKB Lentivirus plasmid |
ORF Viral Vector | pGMPC000527 | Human AURKB Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP005299 | Human AURKB Lentivirus particle |
Target information
Target ID | GM-T46781 |
Target Name | AURKB |
Gene ID | 9212, 20877, 721955, 114592, 101081264, 479492, 360192, 100073050 |
Gene Symbol and Synonyms | AIK2,AIM-1,AIM1,AIRK2,ARK-2,ARK2,AurB,AURKB,aurkb-sv1,aurkb-sv2,IPL1,PPP1R48,STK-1,STK12,STK5 |
Uniprot Accession | Q96GD4 |
Uniprot Entry Name | AURKB_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000178999 |
Target Classification | Kinase, Tumor-associated antigen (TAA) |
This gene encodes a member of the aurora kinase subfamily of serine/threonine kinases. The genes encoding the other two members of this subfamily are located on chromosomes 19 and 20. These kinases participate in the regulation of alignment and segregation of chromosomes during mitosis and meiosis through association with microtubules. A pseudogene of this gene is located on chromosome 8. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.