Human YBX1/BP-8/ CBF-A ORF/cDNA clone-Lentivirus particle (NM_004559.5)
Pre-made Human YBX1/BP-8/ CBF-A Lentiviral expression plasmid for YBX1 lentivirus packaging, YBX1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to YBX1/BP-8 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV001113 | Human YBX1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV001113 |
Gene Name | YBX1 |
Accession Number | NM_004559.5 |
Gene ID | 4904 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 975 bp |
Gene Alias | BP-8, CBF-A, CSDA2, CSDB, DBPB, EFI-A, MDR-NF1, NSEP-1, NSEP1, YB-1, YB1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | GST(C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGCAGCGAGGCCGAGACCCAGCAGCCGCCCGCCGCCCCCCCCGCCGCCCCCGCCCTCAGCGCCGCCGACACCAAGCCCGGCACTACGGGCAGCGGCGCAGGGAGCGGTGGCCCGGGCGGCCTCACATCGGCGGCGCCTGCCGGCGGGGACAAGAAGGTCATCGCAACGAAGGTTTTGGGAACAGTAAAATGGTTCAATGTAAGGAACGGATATGGTTTCATCAACAGGAATGACACCAAGGAAGATGTATTTGTACACCAGACTGCCATAAAGAAGAATAACCCCAGGAAGTACCTTCGCAGTGTAGGAGATGGAGAGACTGTGGAGTTTGATGTTGTTGAAGGAGAAAAGGGTGCGGAGGCAGCAAATGTTACAGGTCCTGGTGGTGTTCCAGTTCAAGGCAGTAAATATGCAGCAGACCGTAACCATTATAGACGCTATCCACGTCGTAGGGGTCCTCCACGCAATTACCAGCAAAATTACCAGAATAGTGAGAGTGGGGAAAAGAACGAGGGATCGGAGAGTGCTCCCGAAGGCCAGGCCCAACAACGCCGGCCCTACCGCAGGCGAAGGTTCCCACCTTACTACATGCGGAGACCCTATGGGCGTCGACCACAGTATTCCAACCCTCCTGTGCAGGGAGAAGTGATGGAGGGTGCTGACAACCAGGGTGCAGGAGAACAAGGTAGACCAGTGAGGCAGAATATGTATCGGGGATATAGACCACGATTCCGCAGGGGCCCTCCTCGCCAAAGACAGCCTAGAGAGGACGGCAATGAAGAAGATAAAGAAAATCAAGGAGATGAGACCCAAGGTCAGCAGCCACCTCAACGTCGGTACCGCCGCAACTTCAATTACCGACGCAGACGCCCAGAAAACCCTAAACCACAAGATGGCAAAGAGACAAAAGCAGCCGATCCACCAGCTGAGAATTCGTCCGCTCCCGAGGCTGAGCAGGGCGGGGCTGAGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP1951-Ab | Anti-YBOX1/ YBX1/ BP-8 monoclonal antibody |
Target Antigen | GM-Tg-g-MP1951-Ag | YBX1 VLP (virus-like particle) |
ORF Viral Vector | pGMLV000237 | Human YBX1 Lentivirus plasmid |
ORF Viral Vector | pGMLV001113 | Human YBX1 Lentivirus plasmid |
ORF Viral Vector | pGMPC000735 | Human YBX1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLV000237 | Human YBX1 Lentivirus particle |
ORF Viral Vector | vGMLV001113 | Human YBX1 Lentivirus particle |
Target information
Target ID | GM-MP1951 |
Target Name | YBX1 |
Gene ID | 4904, 22608, 700140, 500538, 102900263, 607025, 287023, 100067336 |
Gene Symbol and Synonyms | 1700102N10Rik,BP-8,Byb1,CBF-A,Cbfa,CSDA2,CSDB,DBPB,EF1A,EFI-A,MDR-NF1,MSY1,mYB-1a,NSEP-1,NSEP1,YB-1,YB1,YBX1 |
Uniprot Accession | P67809 |
Uniprot Entry Name | YBOX1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Cancer |
Gene Ensembl | ENSG00000065978 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a highly conserved cold shock domain protein that has broad nucleic acid binding properties. The encoded protein functions as both a DNA and RNA binding protein and has been implicated in numerous cellular processes including regulation of transcription and translation, pre-mRNA splicing, DNA reparation and mRNA packaging. This protein is also a component of messenger ribonucleoprotein (mRNP) complexes and may have a role in microRNA processing. This protein can be secreted through non-classical pathways and functions as an extracellular mitogen. Aberrant expression of the gene is associated with cancer proliferation in numerous tissues. This gene may be a prognostic marker for poor outcome and drug resistance in certain cancers. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on multiple chromosomes. [provided by RefSeq, Sep 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.