Human YBX1/BP-8/ CBF-A ORF/cDNA clone-Lentivirus particle (NM_004559.5)

Pre-made Human YBX1/BP-8/ CBF-A Lentiviral expression plasmid for YBX1 lentivirus packaging, YBX1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to YBX1/BP-8 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV001113 Human YBX1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV001113
Gene Name YBX1
Accession Number NM_004559.5
Gene ID 4904
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 975 bp
Gene Alias BP-8, CBF-A, CSDA2, CSDB, DBPB, EFI-A, MDR-NF1, NSEP-1, NSEP1, YB-1, YB1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag GST(C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGCAGCGAGGCCGAGACCCAGCAGCCGCCCGCCGCCCCCCCCGCCGCCCCCGCCCTCAGCGCCGCCGACACCAAGCCCGGCACTACGGGCAGCGGCGCAGGGAGCGGTGGCCCGGGCGGCCTCACATCGGCGGCGCCTGCCGGCGGGGACAAGAAGGTCATCGCAACGAAGGTTTTGGGAACAGTAAAATGGTTCAATGTAAGGAACGGATATGGTTTCATCAACAGGAATGACACCAAGGAAGATGTATTTGTACACCAGACTGCCATAAAGAAGAATAACCCCAGGAAGTACCTTCGCAGTGTAGGAGATGGAGAGACTGTGGAGTTTGATGTTGTTGAAGGAGAAAAGGGTGCGGAGGCAGCAAATGTTACAGGTCCTGGTGGTGTTCCAGTTCAAGGCAGTAAATATGCAGCAGACCGTAACCATTATAGACGCTATCCACGTCGTAGGGGTCCTCCACGCAATTACCAGCAAAATTACCAGAATAGTGAGAGTGGGGAAAAGAACGAGGGATCGGAGAGTGCTCCCGAAGGCCAGGCCCAACAACGCCGGCCCTACCGCAGGCGAAGGTTCCCACCTTACTACATGCGGAGACCCTATGGGCGTCGACCACAGTATTCCAACCCTCCTGTGCAGGGAGAAGTGATGGAGGGTGCTGACAACCAGGGTGCAGGAGAACAAGGTAGACCAGTGAGGCAGAATATGTATCGGGGATATAGACCACGATTCCGCAGGGGCCCTCCTCGCCAAAGACAGCCTAGAGAGGACGGCAATGAAGAAGATAAAGAAAATCAAGGAGATGAGACCCAAGGTCAGCAGCCACCTCAACGTCGGTACCGCCGCAACTTCAATTACCGACGCAGACGCCCAGAAAACCCTAAACCACAAGATGGCAAAGAGACAAAAGCAGCCGATCCACCAGCTGAGAATTCGTCCGCTCCCGAGGCTGAGCAGGGCGGGGCTGAGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1951-Ab Anti-YBOX1/ YBX1/ BP-8 monoclonal antibody
    Target Antigen GM-Tg-g-MP1951-Ag YBX1 VLP (virus-like particle)
    ORF Viral Vector pGMLV000237 Human YBX1 Lentivirus plasmid
    ORF Viral Vector pGMLV001113 Human YBX1 Lentivirus plasmid
    ORF Viral Vector pGMPC000735 Human YBX1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000237 Human YBX1 Lentivirus particle
    ORF Viral Vector vGMLV001113 Human YBX1 Lentivirus particle


    Target information

    Target ID GM-MP1951
    Target Name YBX1
    Gene ID 4904, 22608, 700140, 500538, 102900263, 607025, 287023, 100067336
    Gene Symbol and Synonyms 1700102N10Rik,BP-8,Byb1,CBF-A,Cbfa,CSDA2,CSDB,DBPB,EF1A,EFI-A,MDR-NF1,MSY1,mYB-1a,NSEP-1,NSEP1,YB-1,YB1,YBX1
    Uniprot Accession P67809
    Uniprot Entry Name YBOX1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000065978
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a highly conserved cold shock domain protein that has broad nucleic acid binding properties. The encoded protein functions as both a DNA and RNA binding protein and has been implicated in numerous cellular processes including regulation of transcription and translation, pre-mRNA splicing, DNA reparation and mRNA packaging. This protein is also a component of messenger ribonucleoprotein (mRNP) complexes and may have a role in microRNA processing. This protein can be secreted through non-classical pathways and functions as an extracellular mitogen. Aberrant expression of the gene is associated with cancer proliferation in numerous tissues. This gene may be a prognostic marker for poor outcome and drug resistance in certain cancers. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on multiple chromosomes. [provided by RefSeq, Sep 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.