- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human SLC1A5/AAAT/ ASCT2 ORF/cDNA clone-Lentivirus particle (NM_001145145.1)
Pre-made Human SLC1A5/AAAT/ ASCT2 Lentiviral expression plasmid for SLC1A5 lentivirus packaging, SLC1A5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to SLC1A5/AAAT products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLV001142 | Human SLC1A5 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLV001142 |
| Gene Name | SLC1A5 |
| Accession Number | NM_001145145.1 |
| Gene ID | 6510 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1020 bp |
| Gene Alias | AAAT, ASCT2, ATBO, M7V1, M7VS1, R16, RDRC |
| Fluorescent Reporter | |
| Mammalian Cell Selection | Puromyocinmyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGTACTCTACCACCTATGAAGAGAGGAATATCACCGGAACCAGGGTGAAGGTGCCCGTGGGGCAGGAGGTGGAGGGGATGAACATCCTGGGCTTGGTAGTGTTTGCCATCGTCTTTGGTGTGGCGCTGCGGAAGCTGGGGCCTGAAGGGGAGCTGCTTATCCGCTTCTTCAACTCCTTCAATGAGGCCACCATGGTTCTGGTCTCCTGGATCATGTGGTACGCCCCTGTGGGCATCATGTTCCTGGTGGCTGGCAAGATCGTGGAGATGGAGGATGTGGGTTTACTCTTTGCCCGCCTTGGCAAGTACATTCTGTGCTGCCTGCTGGGTCACGCCATCCATGGGCTCCTGGTACTGCCCCTCATCTACTTCCTCTTCACCCGCAAAAACCCCTACCGCTTCCTGTGGGGCATCGTGACGCCGCTGGCCACTGCCTTTGGGACCTCTTCCAGTTCCGCCACGCTGCCGCTGATGATGAAGTGCGTGGAGGAGAATAATGGCGTGGCCAAGCACATCAGCCGTTTCATCCTGCCCATCGGCGCCACCGTCAACATGGACGGTGCCGCGCTCTTCCAGTGCGTGGCCGCAGTGTTCATTGCACAGCTCAGCCAGCAGTCCTTGGACTTCGTAAAGATCATCACCATCCTGGTCACGGCCACAGCGTCCAGCGTGGGGGCAGCGGGCATCCCTGCTGGAGGTGTCCTCACTCTGGCCATCATCCTCGAAGCAGTCAACCTCCCGGTCGACCATATCTCCTTGATCCTGGCTGTGGACTGGCTAGTCGACCGGTCCTGTACCGTCCTCAATGTAGAAGGTGACGCTCTGGGGGCAGGACTCCTCCAAAATTACGTGGACCGTACGGAGTCGAGAAGCACAGAGCCTGAGTTGATACAAGTGAAGAGTGAGCTGCCCCTGGATCCGCTGCCAGTCCCCACTGAGGAAGGAAACCCCCTCCTCAAACACTATCGGGGGCCCGCAGGGGATGCCACGGTCGCCTCTGAGAAGGAATCAGTCATGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Biosimilar | GMP-Bios-ab-260 | Pre-Made Idactamab biosimilar, Whole mAb, Anti-SLC1A5 Antibody: Anti-AAAT/ASCT2/ATBO/M7V1/M7VS1/R16/RDRC therapeutic antibody |
| Target Antibody | GM-Tg-g-T59493-Ab | Anti-AAAT/ SLC1A5/ ASCT2 monoclonal antibody |
| Target Antigen | GM-Tg-g-T59493-Ag | SLC1A5 VLP (virus-like particle) |
| ORF Viral Vector | pGMLV001142 | Human SLC1A5 Lentivirus plasmid |
| ORF Viral Vector | pGMLV002011 | Human SLC1A5 Lentivirus plasmid |
| ORF Viral Vector | pGMAD000187 | Human SLC1A5 Adenovirus plasmid |
| ORF Viral Vector | pGMAD000450 | Human SLC1A5 Adenovirus plasmid |
| ORF Viral Vector | vGMLV001142 | Human SLC1A5 Lentivirus particle |
| ORF Viral Vector | vGMLV002011 | Human SLC1A5 Lentivirus particle |
| ORF Viral Vector | vGMAD000187 | Human SLC1A5 Adenovirus particle |
| ORF Viral Vector | vGMAD000450 | Human SLC1A5 Adenovirus particle |
Target information
| Target ID | GM-T59493 |
| Target Name | SLC1A5 |
| Gene ID | 6510, 20514, 716843, 292657, 101090567, 484425, 282355, 100146913 |
| Gene Symbol and Synonyms | AAAT,ASCT2,ATB(0),ATBO,H4-ASCT2,M7V1,M7VS1,R16,RDRC,SLC1A5,Slc1a7 |
| Uniprot Accession | Q15758 |
| Uniprot Entry Name | AAAT_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target, INN Index |
| Disease | Not Available |
| Gene Ensembl | ENSG00000105281 |
| Target Classification | Not Available |
The SLC1A5 gene encodes a sodium-dependent neutral amino acid transporter that can act as a receptor for RD114/type D retrovirus (Larriba et al., 2001 [PubMed 11781704]).[supplied by OMIM, Jan 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
