Human YAP1/COB1/ YAP ORF/cDNA clone-Lentivirus particle (NM_001130145)

Pre-made Human YAP1/COB1/ YAP Lentiviral expression plasmid for YAP1 lentivirus packaging, YAP1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to YAP1/COB1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV001285 Human YAP1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV001285
Gene Name YAP1
Accession Number NM_001130145
Gene ID 10413
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1515 bp
Gene Alias COB1, YAP, YAP2, YAP65, YKI
Fluorescent Reporter mCherry
Mammalian Cell Selection Blasticidin (BSD)
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGATCCCGGGCAGCAGCCGCCGCCTCAACCGGCCCCCCAGGGCCAAGGGCAGCCGCCTTCGCAGCCCCCGCAGGGGCAGGGCCCGCCGTCCGGACCCGGGCAACCGGCACCCGCGGCGACCCAGGCGGCGCCGCAGGCACCCCCCGCCGGGCATCAGATCGTGCACGTCCGCGGGGACTCGGAGACCGACCTGGAGGCGCTCTTCAACGCCGTCATGAACCCCAAGACGGCCAACGTGCCCCAGACCGTGCCCATGAGGCTCCGGAAGCTGCCCGACTCCTTCTTCAAGCCGCCGGAGCCCAAATCCCACTCCCGACAGGCCAGTACTGATGCAGGCACTGCAGGAGCCCTGACTCCACAGCATGTTCGAGCTCATTCCTCTCCAGCTTCTCTGCAGTTGGGAGCTGTTTCTCCTGGGACACTGACCCCCACTGGAGTAGTCTCTGGCCCAGCAGCTACACCCACAGCTCAGCATCTTCGACAGTCTTCTTTTGAGATACCTGATGATGTACCTCTGCCAGCAGGTTGGGAGATGGCAAAGACATCTTCTGGTCAGAGATACTTCTTAAATCACATCGATCAGACAACAACATGGCAGGACCCCAGGAAGGCCATGCTGTCCCAGATGAACGTCACAGCCCCCACCAGTCCACCAGTGCAGCAGAATATGATGAACTCGGCTTCAGGTCCTCTTCCTGATGGATGGGAACAAGCCATGACTCAGGATGGAGAAATTTACTATATAAACCATAAGAACAAGACCACCTCTTGGCTAGACCCAAGGCTTGACCCTCGTTTTGCCATGAACCAGAGAATCAGTCAGAGTGCTCCAGTGAAACAGCCACCACCCCTGGCTCCCCAGAGCCCACAGGGAGGCGTCATGGGTGGCAGCAACTCCAACCAGCAGCAACAGATGCGACTGCAGCAACTGCAGATGGAGAAGGAGAGGCTGCGGCTGAAACAGCAAGAACTGCTTCGGCAGGCAATGCGGAATATCAATCCCAGCACAGCAAATTCTCCAAAATGTCAGGAGTTAGCCCTGCGTAGCCAGTTACCAACACTGGAGCAGGATGGTGGGACTCAAAATCCAGTGTCTTCTCCCGGGATGTCTCAGGAATTGAGAACAATGACGACCAATAGCTCAGATCCTTTCCTTAACAGTGGCACCTATCACTCTCGAGATGAGAGTACAGACAGTGGACTAAGCATGAGCAGCTACAGTGTCCCTCGAACCCCAGATGACTTCCTGAACAGTGTGGATGAGATGGATACAGGTGATACTATCAACCAAAGCACCCTGCCCTCACAGCAGAACCGTTTCCCAGACTACCTTGAAGCCATTCCTGGGACAAATGTGGACCTTGGAACACTGGAAGGAGATGGAATGAACATAGAAGGAGAGGAGCTGATGCCAAGTCTGCAGGAAGCTTTGAGTTCTGACATCCTTAATGACATGGAGTCTGTTTTGGCTGCCACCAAGCTAGATAAAGAAAGCTTTCTTACATGGTTATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T94048-Ab Anti-YAP1 monoclonal antibody
    Target Antigen GM-Tg-g-T94048-Ag YAP1 protein
    ORF Viral Vector pGMLV000392 Human YAP1 Lentivirus plasmid
    ORF Viral Vector pGMLV000567 Human YAP1 Lentivirus plasmid
    ORF Viral Vector pGMLV000777 Human YAP1 Lentivirus plasmid
    ORF Viral Vector pGMLV000998 Human YAP1 Lentivirus plasmid
    ORF Viral Vector pGMLV001167 Human YAP1 Lentivirus plasmid
    ORF Viral Vector pGMLV001168 Human YAP1 Lentivirus plasmid
    ORF Viral Vector pGMLV001285 Human YAP1 Lentivirus plasmid
    ORF Viral Vector pGMAD000063 Human YAP1 Adenovirus plasmid
    ORF Viral Vector pGMAD000620 Human YAP1 Adenovirus plasmid
    ORF Viral Vector pGMAAV000314 Human YAP1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000884 Human YAP1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC000428 Human YAP1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000964 Human YAP1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001203 Human YAP1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP-SPh-021 Human YAP1 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-161 Human YAP1 Adenovirus plasmid
    ORF Viral Vector vGMLV000392 Human YAP1 Lentivirus particle
    ORF Viral Vector vGMLV000567 Human YAP1 Lentivirus particle
    ORF Viral Vector vGMLV000777 Human YAP1 Lentivirus particle
    ORF Viral Vector vGMLV000998 Human YAP1 Lentivirus particle
    ORF Viral Vector vGMLV001167 Human YAP1 Lentivirus particle
    ORF Viral Vector vGMLV001168 Human YAP1 Lentivirus particle
    ORF Viral Vector vGMLV001285 Human YAP1 Lentivirus particle
    ORF Viral Vector vGMAD000063 Human YAP1 Adenovirus particle
    ORF Viral Vector vGMAD000620 Human YAP1 Adenovirus particle
    ORF Viral Vector vGMAAV000314 Human YAP1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000884 Human YAP1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP-SPh-021 Human YAP1 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-161 Human YAP1 Adenovirus particle
    ORF Viral Vector pGMLV002267 Human YAP1 Lentivirus plasmid
    ORF Viral Vector pGMLV002426 Human YAP1 Lentivirus plasmid


    Target information

    Target ID GM-T94048
    Target Name YAP1
    Gene ID 10413, 22601, 704382, 363014, 101101408, 479465, 100336629, 100068834
    Gene Symbol and Synonyms COB1,YAP,YAP-1,YAP-65,YAP1,YAP2,YAP65,YKI,Yorkie
    Uniprot Accession P46937
    Uniprot Entry Name YAP1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000137693
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a downstream nuclear effector of the Hippo signaling pathway which is involved in development, growth, repair, and homeostasis. This gene is known to play a role in the development and progression of multiple cancers as a transcriptional regulator of this signaling pathway and may function as a potential target for cancer treatment. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2013]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.