Human GDNF/ATF/ ATF1 ORF/cDNA clone-Lentivirus particle (NM_001190468)

Pre-made Human GDNF/ATF/ ATF1 Lentiviral expression plasmid for GDNF lentivirus packaging, GDNF lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to GDNF/ATF products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV001834 Human GDNF Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV001834
Gene Name GDNF
Accession Number NM_001190468
Gene ID 2668
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 687 bp
Gene Alias ATF, ATF1, ATF2, HFB1-GDNF, HSCR3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAGTCTTTGCCTAACAGCAATGGTGCCGCCGCCGGACGGGACTTTAAGATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGCTGCTCCACACCGCGTCCGCCTTCCCGCTGCCCGCCGGTAAGAGGCCTCCCGAGGCGCCCGCCGAAGACCGCTCCCTCGGCCGCCGCCGCGCGCCCTTCGCGCTGAGCAGTGACTCAAATATGCCAGAGGATTATCCTGATCAGTTCGATGATGTCATGGATTTTATTCAAGCCACCATTAAAAGACTGAAAAGGTCACCAGATAAACAAATGGCAGTGCTTCCTAGAAGAGAGCGGAATCGGCAGGCTGCAGCTGCCAACCCAGAGAATTCCAGAGGAAAAGGTCGGAGAGGCCAGAGGGGCAAAAACCGGGGTTGTGTCTTAACTGCAATACATTTAAATGTCACTGACTTGGGTCTGGGCTATGAAACCAAGGAGGAACTGATTTTTAGGTACTGCAGCGGCTCTTGCGATGCAGCTGAGACAACGTACGACAAAATATTGAAAAACTTATCCAGAAATAGAAGGCTGGTGAGTGACAAAGTAGGGCAGGCATGTTGCAGACCCATCGCCTTTGATGATGACCTGTCGTTTTTAGATGATAACCTGGTTTACCATATTCTAAGAAAGCATTCCGCTAAAAGGTGTGGATGTATCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T79160-Ab Anti-GDNF/ ATF/ ATF1 functional antibody
    Target Antigen GM-Tg-g-T79160-Ag GDNF protein
    Cytokine cks-Tg-g-GM-T79160 glial cell derived neurotrophic factor (GDNF) protein & antibody
    ORF Viral Vector pGMLV000093 Rat Gdnf Lentivirus plasmid
    ORF Viral Vector pGMLV000366 Human GDNF Lentivirus plasmid
    ORF Viral Vector pGMLV000484 Human GDNF Lentivirus plasmid
    ORF Viral Vector pGMLV000814 Rat Gdnf Lentivirus plasmid
    ORF Viral Vector pGMLV001834 Human GDNF Lentivirus plasmid
    ORF Viral Vector pGMLP002678 Human GDNF Lentivirus plasmid
    ORF Viral Vector vGMLV000093 Rat Gdnf Lentivirus particle
    ORF Viral Vector vGMLV000366 Human GDNF Lentivirus particle
    ORF Viral Vector vGMLV000484 Human GDNF Lentivirus particle
    ORF Viral Vector vGMLV000814 Rat Gdnf Lentivirus particle
    ORF Viral Vector vGMLV001834 Human GDNF Lentivirus particle
    ORF Viral Vector vGMLP002678 Human GDNF Lentivirus particle
    ORF Viral Vector pGMLV002117 Rat Gdnf Lentivirus plasmid


    Target information

    Target ID GM-T79160
    Target Name GDNF
    Gene ID 2668, 14573, 706345, 25453, 101097871, 119871563, 386587, 100067053
    Gene Symbol and Synonyms ATF,ATF1,ATF2,GDNF,gndf,HFB1-GDNF,HSCR3
    Uniprot Accession P39905
    Uniprot Entry Name GDNF_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target, Cytokine Target
    Disease Lung Cancer
    Gene Ensembl ENSG00000168621
    Target Classification Checkpoint-Immuno Oncology

    This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The recombinant form of this protein, a highly conserved neurotrophic factor, was shown to promote the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. This protein is a ligand for the product of the RET (rearranged during transfection) protooncogene. Mutations in this gene may be associated with Hirschsprung disease and Tourette syndrome. This gene encodes multiple protein isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.