Human GDNF/ATF/ ATF1 ORF/cDNA clone-Lentivirus plasmid (NM_001190468)
Pre-made Human GDNF/ATF/ ATF1 Lentiviral expression plasmid for GDNF lentivirus packaging, GDNF lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to GDNF/ATF products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLV001834 | Human GDNF Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLV001834 |
Gene Name | GDNF |
Accession Number | NM_001190468 |
Gene ID | 2668 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 687 bp |
Gene Alias | ATF, ATF1, ATF2, HFB1-GDNF, HSCR3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCAGTCTTTGCCTAACAGCAATGGTGCCGCCGCCGGACGGGACTTTAAGATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGCTGCTCCACACCGCGTCCGCCTTCCCGCTGCCCGCCGGTAAGAGGCCTCCCGAGGCGCCCGCCGAAGACCGCTCCCTCGGCCGCCGCCGCGCGCCCTTCGCGCTGAGCAGTGACTCAAATATGCCAGAGGATTATCCTGATCAGTTCGATGATGTCATGGATTTTATTCAAGCCACCATTAAAAGACTGAAAAGGTCACCAGATAAACAAATGGCAGTGCTTCCTAGAAGAGAGCGGAATCGGCAGGCTGCAGCTGCCAACCCAGAGAATTCCAGAGGAAAAGGTCGGAGAGGCCAGAGGGGCAAAAACCGGGGTTGTGTCTTAACTGCAATACATTTAAATGTCACTGACTTGGGTCTGGGCTATGAAACCAAGGAGGAACTGATTTTTAGGTACTGCAGCGGCTCTTGCGATGCAGCTGAGACAACGTACGACAAAATATTGAAAAACTTATCCAGAAATAGAAGGCTGGTGAGTGACAAAGTAGGGCAGGCATGTTGCAGACCCATCGCCTTTGATGATGACCTGTCGTTTTTAGATGATAACCTGGTTTACCATATTCTAAGAAAGCATTCCGCTAAAAGGTGTGGATGTATCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T79160-Ab | Anti-GDNF/ ATF/ ATF1 functional antibody |
Target Antigen | GM-Tg-g-T79160-Ag | GDNF protein |
Cytokine | cks-Tg-g-GM-T79160 | glial cell derived neurotrophic factor (GDNF) protein & antibody |
ORF Viral Vector | pGMLV000093 | Rat Gdnf Lentivirus plasmid |
ORF Viral Vector | pGMLV000366 | Human GDNF Lentivirus plasmid |
ORF Viral Vector | pGMLV000484 | Human GDNF Lentivirus plasmid |
ORF Viral Vector | pGMLV000814 | Rat Gdnf Lentivirus plasmid |
ORF Viral Vector | pGMLV001834 | Human GDNF Lentivirus plasmid |
ORF Viral Vector | pGMLP002678 | Human GDNF Lentivirus plasmid |
ORF Viral Vector | vGMLV000093 | Rat Gdnf Lentivirus particle |
ORF Viral Vector | vGMLV000366 | Human GDNF Lentivirus particle |
ORF Viral Vector | vGMLV000484 | Human GDNF Lentivirus particle |
ORF Viral Vector | vGMLV000814 | Rat Gdnf Lentivirus particle |
ORF Viral Vector | vGMLV001834 | Human GDNF Lentivirus particle |
ORF Viral Vector | vGMLP002678 | Human GDNF Lentivirus particle |
ORF Viral Vector | pGMLV002117 | Rat Gdnf Lentivirus plasmid |
Target information
Target ID | GM-T79160 |
Target Name | GDNF |
Gene ID | 2668, 14573, 706345, 25453, 101097871, 119871563, 386587, 100067053 |
Gene Symbol and Synonyms | ATF,ATF1,ATF2,GDNF,gndf,HFB1-GDNF,HSCR3 |
Uniprot Accession | P39905 |
Uniprot Entry Name | GDNF_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Immuno-oncology Target, Cytokine Target |
Disease | Lung Cancer |
Gene Ensembl | ENSG00000168621 |
Target Classification | Checkpoint-Immuno Oncology |
This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The recombinant form of this protein, a highly conserved neurotrophic factor, was shown to promote the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. This protein is a ligand for the product of the RET (rearranged during transfection) protooncogene. Mutations in this gene may be associated with Hirschsprung disease and Tourette syndrome. This gene encodes multiple protein isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.