Human IL24/C49A/ FISP ORF/cDNA clone-Adenovirus plasmid (NM_006850)

Pre-made Human IL24/C49A/ FISP adenoviral expression plasmid for IL24 adenovirus packaging, IL24 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to IL24/C49A products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP-IL-114 Human IL24 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP-IL-114
Gene Name IL24
Accession Number NM_006850
Gene ID 11009
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 621 bp
Gene Alias C49A, FISP, IL10B, MDA7, MOB5, ST16
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAATTTTCAACAGAGGCTGCAAAGCCTGTGGACTTTAGCCAGACCCTTCTGCCCTCCTTTGCTGGCGACAGCCTCTCAAATGCAGATGGTTGTGCTCCCTTGCCTGGGTTTTACCCTGCTTCTCTGGAGCCAGGTATCAGGGGCCCAGGGCCAAGAATTCCACTTTGGGCCCTGCCAAGTGAAGGGGGTTGTTCCCCAGAAACTGTGGGAAGCCTTCTGGGCTGTGAAAGACACTATGCAAGCTCAGGATAACATCACGAGTGCCCGGCTGCTGCAGCAGGAGGTTCTGCAGAACGTCTCGGATGCTGAGAGCTGTTACCTTGTCCACACCCTGCTGGAGTTCTACTTGAAAACTGTTTTCAAAAACTACCACAATAGAACAGTTGAAGTCAGGACTCTGAAGTCATTCTCTACTCTGGCCAACAACTTTGTTCTCATCGTGTCACAACTGCAACCCAGTCAAGAAAATGAGATGTTTTCCATCAGAGACAGTGCACACAGGCGGTTTCTGCTATTCCGGAGAGCATTCAAACAGTTGGACGTAGAAGCAGCTCTGACCAAAGCCCTTGGGGAAGTGGACATTCTTCTGACCTGGATGCAGAAATTCTACAAGCTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T93450-Ab Anti-IL24/ C49A/ FISP functional antibody
    Target Antigen GM-Tg-g-T93450-Ag IL24 protein
    Cytokine cks-Tg-g-GM-T93450 interleukin 24 (IL24) protein & antibody
    ORF Viral Vector pGMLV000181 Human IL24 Lentivirus plasmid
    ORF Viral Vector pGMAD000195 Human IL24 Adenovirus plasmid
    ORF Viral Vector pGMLP-IL-031 Human IL24 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-114 Human IL24 Adenovirus plasmid
    ORF Viral Vector vGMLV000181 Human IL24 Lentivirus particle
    ORF Viral Vector vGMAD000195 Human IL24 Adenovirus particle
    ORF Viral Vector vGMLP-IL-031 Human IL24 Lentivirus particle
    ORF Viral Vector vGMAP-IL-114 Human IL24 Adenovirus particle


    Target information

    Target ID GM-T93450
    Target Name IL24
    Gene ID 11009, 93672, 694541, 170819, 101095874, 609213, 526285, 100055675
    Gene Symbol and Synonyms C49A,FISP,If2e,IL10B,IL24,Mda-7,MDA7,MOB5,ST16
    Uniprot Accession Q13007
    Uniprot Entry Name IL24_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000162892
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of the IL10 family of cytokines. It was identified as a gene induced during terminal differentiation in melanoma cells. The protein encoded by this gene can induce apoptosis selectively in various cancer cells. Overexpression of this gene leads to elevated expression of several GADD family genes, which correlates with the induction of apoptosis. The phosphorylation of mitogen-activated protein kinase 14 (MAPK7/P38), and heat shock 27kDa protein 1 (HSPB2/HSP27) are found to be induced by this gene in melanoma cells, but not in normal immortal melanocytes. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.