Human IL24/C49A/ FISP ORF/cDNA clone-Adenovirus particle (NM_006850)
Pre-made Human IL24/C49A/ FISP Adenovirus for IL24 overexpression in-vitro and in-vivo. The IL24 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified IL24-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to IL24/C49A products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP-IL-114 | Human IL24 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP-IL-114 |
Gene Name | IL24 |
Accession Number | NM_006850 |
Gene ID | 11009 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 621 bp |
Gene Alias | C49A, FISP, IL10B, MDA7, MOB5, ST16 |
Fluorescent Reporter | EGFP |
Mammalian Cell Selection | |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAATTTTCAACAGAGGCTGCAAAGCCTGTGGACTTTAGCCAGACCCTTCTGCCCTCCTTTGCTGGCGACAGCCTCTCAAATGCAGATGGTTGTGCTCCCTTGCCTGGGTTTTACCCTGCTTCTCTGGAGCCAGGTATCAGGGGCCCAGGGCCAAGAATTCCACTTTGGGCCCTGCCAAGTGAAGGGGGTTGTTCCCCAGAAACTGTGGGAAGCCTTCTGGGCTGTGAAAGACACTATGCAAGCTCAGGATAACATCACGAGTGCCCGGCTGCTGCAGCAGGAGGTTCTGCAGAACGTCTCGGATGCTGAGAGCTGTTACCTTGTCCACACCCTGCTGGAGTTCTACTTGAAAACTGTTTTCAAAAACTACCACAATAGAACAGTTGAAGTCAGGACTCTGAAGTCATTCTCTACTCTGGCCAACAACTTTGTTCTCATCGTGTCACAACTGCAACCCAGTCAAGAAAATGAGATGTTTTCCATCAGAGACAGTGCACACAGGCGGTTTCTGCTATTCCGGAGAGCATTCAAACAGTTGGACGTAGAAGCAGCTCTGACCAAAGCCCTTGGGGAAGTGGACATTCTTCTGACCTGGATGCAGAAATTCTACAAGCTCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T93450-Ab | Anti-IL24/ C49A/ FISP functional antibody |
Target Antigen | GM-Tg-g-T93450-Ag | IL24 protein |
Cytokine | cks-Tg-g-GM-T93450 | interleukin 24 (IL24) protein & antibody |
ORF Viral Vector | pGMLV000181 | Human IL24 Lentivirus plasmid |
ORF Viral Vector | pGMAD000195 | Human IL24 Adenovirus plasmid |
ORF Viral Vector | pGMLP-IL-031 | Human IL24 Lentivirus plasmid |
ORF Viral Vector | pGMAP-IL-114 | Human IL24 Adenovirus plasmid |
ORF Viral Vector | vGMLV000181 | Human IL24 Lentivirus particle |
ORF Viral Vector | vGMAD000195 | Human IL24 Adenovirus particle |
ORF Viral Vector | vGMLP-IL-031 | Human IL24 Lentivirus particle |
ORF Viral Vector | vGMAP-IL-114 | Human IL24 Adenovirus particle |
Target information
Target ID | GM-T93450 |
Target Name | IL24 |
Gene ID | 11009, 93672, 694541, 170819, 101095874, 609213, 526285, 100055675 |
Gene Symbol and Synonyms | C49A,FISP,If2e,IL10B,IL24,Mda-7,MDA7,MOB5,ST16 |
Uniprot Accession | Q13007 |
Uniprot Entry Name | IL24_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000162892 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a member of the IL10 family of cytokines. It was identified as a gene induced during terminal differentiation in melanoma cells. The protein encoded by this gene can induce apoptosis selectively in various cancer cells. Overexpression of this gene leads to elevated expression of several GADD family genes, which correlates with the induction of apoptosis. The phosphorylation of mitogen-activated protein kinase 14 (MAPK7/P38), and heat shock 27kDa protein 1 (HSPB2/HSP27) are found to be induced by this gene in melanoma cells, but not in normal immortal melanocytes. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.