Human SMAD3/DKFZP586N0721/ HSPC193 ORF/cDNA clone-Adenovirus plasmid (BC050743)

Pre-made Human SMAD3/DKFZP586N0721/ HSPC193 adenoviral expression plasmid for SMAD3 adenovirus packaging, SMAD3 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to SMAD3/DKFZP586N0721 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP-SPh-185 Human SMAD3 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP-SPh-185
Gene Name SMAD3
Accession Number BC050743
Gene ID 4088
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 1278 bp
Gene Alias DKFZP586N0721, HSPC193, HsT17436, JV15-2, MGC60396, Smad 3
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCGTCCATCCTGCCTTTCACTCCCCCGATCGTGAAGCGCCTGCTGGGCTGGAAGAAGGGCGAGCAGAACGGGCAGGAGGAGAAATGGTGCGAGAAGGCGGTCAAGAGCCTGGTCAAGAAACTCAAGAAGACGGGGCAGCTGGACGAGCTGGAGAAGGCCATCACCACGCAGAACGTCAACACCAAGTGCATCACCATCCCCAGGTCCCTGGATGGCCGGTTGCAGGTGTCCCATCGGAAGGGGCTCCCTCATGTCATCTACTGCCGCCTGTGGCGATGGCCAGACCTGCACAGCCACCACGAGCTGCGGGCCATGGAGCTGTGTGAGTTCGCCTTCAATATGAAGAAGGACGAGGTCTGCGTGAATCCCTACCACTACCAGAGAGTAGAGACACCAGTTCTACCTCCTGTGTTGGTGCCACGCCACACAGAGATCCCGGCCGAGTTCCCCCCACTGGACGACTACAGCCATTCCATCCCCGAAAACACTAACTTCCCCGCAGGCATCGAGCCCCAGAGCAATATTCCAGAGACCCCACCCCCTGGCTACCTGAGTGAAGATGGAGAAACCAGTGACCACCAGATGAACCACAGCATGGACGCAGGTTCTCCAAACCTATCCCCGAATCCGATGTCCCCAGCACATAATAACTTGGACCTGCAGCCAGTTACCTACTGCGAGCCGGCCTTCTGGTGCTCCATCTCCTACTACGAGCTGAACCAGCGCGTCGGGGAGACATTCCACGCCTCGCAGCCATCCATGACTGTGGATGGCTTCACCGACCCCTCCAATTCGGAGCGCTTCTGCCTAGGGCTGCTCTCCAATGTCAACAGGAATGCAGCAGTGGAGCTGACACGGAGACACATCGGAAGAGGCGTGCGGCTCTACTACATCGGAGGGGAGGTCTTCGCAGAGTGCCTCAGTGACAGCGCTATTTTTGTCCAGTCTCCCAACTGTAACCAGCGCTATGGCTGGCACCCGGCCACCGTCTGCAAGATCCCACCAGGATGCAACCTGAAGATCTTCAACAACCAGGAGTTCGCTGCCCTCCTGGCCCAGTCGGTCAACCAGGGCTTTGAGGCTGTCTACCAGTTGACCCGAATGTGCACCATCCGCATGAGCTTCGTCAAAGGCTGGGGAGCGGAGTACAGGAGACAGACTGTGACCAGTACCCCCTGCTGGATTGAGCTGCACCTGAATGGGCCTTTGCAGTGGCTTGACAAGGTCCTCACCCAGATGGGCTCCCCAAGCATCCGCTGTTCCAGTGTGTCTTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T35445-Ab Anti-SMAD3 monoclonal antibody
    Target Antigen GM-Tg-g-T35445-Ag SMAD3 protein
    Cytokine cks-Tg-g-GM-T35445 SMAD family member 3 (SMAD3) protein & antibody
    ORF Viral Vector pGMPC000481 Human SMAD3 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP000019 Human SMAD3 Lentivirus plasmid
    ORF Viral Vector pGMAP000252 Human SMAD3 Adenovirus plasmid
    ORF Viral Vector pGMLP-SPh-045 Human SMAD3 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-185 Human SMAD3 Adenovirus plasmid
    ORF Viral Vector vGMLP000019 Human SMAD3 Lentivirus particle
    ORF Viral Vector vGMAP000252 Human SMAD3 Adenovirus particle
    ORF Viral Vector vGMLP-SPh-045 Human SMAD3 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-185 Human SMAD3 Adenovirus particle


    Target information

    Target ID GM-T35445
    Target Name SMAD3
    Gene ID 4088, 17127, 711355, 25631, 101101387, 610902, 515125, 100033845
    Gene Symbol and Synonyms hMAD-3,hSMAD3,HSPC193,HsT17436,JV15-2,LDS1C,LDS3,mad3,MADH3,Smad 3,SMAD3
    Uniprot Accession P84022
    Uniprot Entry Name SMAD3_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000166949
    Target Classification Tumor-associated antigen (TAA)

    The SMAD family of proteins are a group of intracellular signal transducer proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. The SMAD3 protein functions in the transforming growth factor-beta signaling pathway, and transmits signals from the cell surface to the nucleus, regulating gene activity and cell proliferation. This protein forms a complex with other SMAD proteins and binds DNA, functioning both as a transcription factor and tumor suppressor. Mutations in this gene are associated with aneurysms-osteoarthritis syndrome and Loeys-Dietz Syndrome 3. [provided by RefSeq, May 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.