Human SMAD3/DKFZP586N0721/ HSPC193 ORF/cDNA clone-Lentivirus particle (BC050743)
Pre-made Human SMAD3/DKFZP586N0721/ HSPC193 Lentiviral expression plasmid for SMAD3 lentivirus packaging, SMAD3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to SMAD3/DKFZP586N0721 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP-SPh-045 | Human SMAD3 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP-SPh-045 |
Gene Name | SMAD3 |
Accession Number | BC050743 |
Gene ID | 4088 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1278 bp |
Gene Alias | DKFZP586N0721, HSPC193, HsT17436, JV15-2, MGC60396, Smad 3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCGTCCATCCTGCCTTTCACTCCCCCGATCGTGAAGCGCCTGCTGGGCTGGAAGAAGGGCGAGCAGAACGGGCAGGAGGAGAAATGGTGCGAGAAGGCGGTCAAGAGCCTGGTCAAGAAACTCAAGAAGACGGGGCAGCTGGACGAGCTGGAGAAGGCCATCACCACGCAGAACGTCAACACCAAGTGCATCACCATCCCCAGGTCCCTGGATGGCCGGTTGCAGGTGTCCCATCGGAAGGGGCTCCCTCATGTCATCTACTGCCGCCTGTGGCGATGGCCAGACCTGCACAGCCACCACGAGCTGCGGGCCATGGAGCTGTGTGAGTTCGCCTTCAATATGAAGAAGGACGAGGTCTGCGTGAATCCCTACCACTACCAGAGAGTAGAGACACCAGTTCTACCTCCTGTGTTGGTGCCACGCCACACAGAGATCCCGGCCGAGTTCCCCCCACTGGACGACTACAGCCATTCCATCCCCGAAAACACTAACTTCCCCGCAGGCATCGAGCCCCAGAGCAATATTCCAGAGACCCCACCCCCTGGCTACCTGAGTGAAGATGGAGAAACCAGTGACCACCAGATGAACCACAGCATGGACGCAGGTTCTCCAAACCTATCCCCGAATCCGATGTCCCCAGCACATAATAACTTGGACCTGCAGCCAGTTACCTACTGCGAGCCGGCCTTCTGGTGCTCCATCTCCTACTACGAGCTGAACCAGCGCGTCGGGGAGACATTCCACGCCTCGCAGCCATCCATGACTGTGGATGGCTTCACCGACCCCTCCAATTCGGAGCGCTTCTGCCTAGGGCTGCTCTCCAATGTCAACAGGAATGCAGCAGTGGAGCTGACACGGAGACACATCGGAAGAGGCGTGCGGCTCTACTACATCGGAGGGGAGGTCTTCGCAGAGTGCCTCAGTGACAGCGCTATTTTTGTCCAGTCTCCCAACTGTAACCAGCGCTATGGCTGGCACCCGGCCACCGTCTGCAAGATCCCACCAGGATGCAACCTGAAGATCTTCAACAACCAGGAGTTCGCTGCCCTCCTGGCCCAGTCGGTCAACCAGGGCTTTGAGGCTGTCTACCAGTTGACCCGAATGTGCACCATCCGCATGAGCTTCGTCAAAGGCTGGGGAGCGGAGTACAGGAGACAGACTGTGACCAGTACCCCCTGCTGGATTGAGCTGCACCTGAATGGGCCTTTGCAGTGGCTTGACAAGGTCCTCACCCAGATGGGCTCCCCAAGCATCCGCTGTTCCAGTGTGTCTTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T35445-Ab | Anti-SMAD3 monoclonal antibody |
Target Antigen | GM-Tg-g-T35445-Ag | SMAD3 protein |
Cytokine | cks-Tg-g-GM-T35445 | SMAD family member 3 (SMAD3) protein & antibody |
ORF Viral Vector | pGMPC000481 | Human SMAD3 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP000019 | Human SMAD3 Lentivirus plasmid |
ORF Viral Vector | pGMAP000252 | Human SMAD3 Adenovirus plasmid |
ORF Viral Vector | pGMLP-SPh-045 | Human SMAD3 Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-185 | Human SMAD3 Adenovirus plasmid |
ORF Viral Vector | vGMLP000019 | Human SMAD3 Lentivirus particle |
ORF Viral Vector | vGMAP000252 | Human SMAD3 Adenovirus particle |
ORF Viral Vector | vGMLP-SPh-045 | Human SMAD3 Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-185 | Human SMAD3 Adenovirus particle |
Target information
Target ID | GM-T35445 |
Target Name | SMAD3 |
Gene ID | 4088, 17127, 711355, 25631, 101101387, 610902, 515125, 100033845 |
Gene Symbol and Synonyms | hMAD-3,hSMAD3,HSPC193,HsT17436,JV15-2,LDS1C,LDS3,mad3,MADH3,Smad 3,SMAD3 |
Uniprot Accession | P84022 |
Uniprot Entry Name | SMAD3_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000166949 |
Target Classification | Tumor-associated antigen (TAA) |
The SMAD family of proteins are a group of intracellular signal transducer proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. The SMAD3 protein functions in the transforming growth factor-beta signaling pathway, and transmits signals from the cell surface to the nucleus, regulating gene activity and cell proliferation. This protein forms a complex with other SMAD proteins and binds DNA, functioning both as a transcription factor and tumor suppressor. Mutations in this gene are associated with aneurysms-osteoarthritis syndrome and Loeys-Dietz Syndrome 3. [provided by RefSeq, May 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.