Human BNIP3/NIP3 ORF/cDNA clone-Adenovirus plasmid (NM_004052.3)

Pre-made Human BNIP3/NIP3 adenoviral expression plasmid for BNIP3 adenovirus packaging, BNIP3 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to BNIP3/NIP3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP-SPh-256 Human BNIP3 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP-SPh-256
Gene Name BNIP3
Accession Number NM_004052.3
Gene ID 664
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 780 bp
Gene Alias NIP3
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGCGACGCGGCCGCAGATCCGCCCGGCCCCGCCCTGCCCTGTGAGTTCCTCCGGCCGGGCTGCGGGGCTCCGCTCAGTCCGGGAGCGCAGCTGGGCCGCGGCGCTCCGACCTCCGCTTTCCCACCGCCCGCAGCTGAAGCACATCCCGCAGCCCGGCGCGGACTCCGATCGCCGCAGTTGCCCTCTGGCGCCATGTCGCAGAACGGAGCGCCCGGGATGCAGGAGGAGAGCCTGCAGGGCTCCTGGGTAGAACTGCACTTCAGCAATAATGGGAACGGGGGCAGCGTTCCAGCCTCGGTTTCTATTTATAATGGAGACATGGAAAAAATACTGCTGGACGCACAGCATGAGTCTGGACGGAGTAGCTCCAAGAGCTCTCACTGTGACAGCCCACCTCGCTCGCAGACACCACAAGATACCAACAGAGCTTCTGAAACAGATACCCATAGCATTGGAGAGAAAAACAGCTCACAGTCTGAGGAAGATGATATTGAAAGAAGGAAAGAAGTTGAAAGCATCTTGAAGAAAAACTCAGATTGGATATGGGATTGGTCAAGTCGGCCGGAAAATATTCCCCCCAAGGAGTTCCTCTTTAAACACCCGAAGCGCACGGCCACCCTCAGCATGAGGAACACGAGCGTCATGAAGAAAGGGGGCATATTCTCTGCAGAATTTCTGAAAGTTTTCCTTCCATCTCTGCTGCTCTCTCATTTGCTGGCCATCGGATTGGGGATCTATATTGGAAGGCGTCTGACAACCTCCACCAGCACCTTTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0426-Ab Anti-BNIP3 monoclonal antibody
    Target Antigen GM-Tg-g-IP0426-Ag BNIP3 protein
    ORF Viral Vector pGMLV001131 Human BNIP3 Lentivirus plasmid
    ORF Viral Vector pGMAD000162 Human BNIP3 Adenovirus plasmid
    ORF Viral Vector pGMPC000183 Human BNIP3 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLPm004024 Mouse BNIP3 Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-116 Human BNIP3 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-256 Human BNIP3 Adenovirus plasmid
    ORF Viral Vector vGMLV001131 Human BNIP3 Lentivirus particle
    ORF Viral Vector vGMAD000162 Human BNIP3 Adenovirus particle
    ORF Viral Vector vGMLPm004024 Mouse BNIP3 Lentivirus particle
    ORF Viral Vector vGMLP-SPh-116 Human BNIP3 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-256 Human BNIP3 Adenovirus particle


    Target information

    Target ID GM-IP0426
    Target Name BNIP3
    Gene ID 664, 12176, 100426120, 84480, 768094, 607408, 615342, 100051673
    Gene Symbol and Synonyms BNIP3,HABON,NIP3
    Uniprot Accession Q12983
    Uniprot Entry Name BNIP3_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000176171
    Target Classification Tumor-associated antigen (TAA)

    This gene is encodes a mitochondrial protein that contains a BH3 domain and acts as a pro-apoptotic factor. The encoded protein interacts with anti-apoptotic proteins, including the E1B 19 kDa protein and Bcl2. This gene is silenced in tumors by DNA methylation. [provided by RefSeq, Dec 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.