Human BNIP3/NIP3 ORF/cDNA clone-Lentivirus particle (NM_004052)
Pre-made Human BNIP3/NIP3 Lentiviral expression plasmid for BNIP3 lentivirus packaging, BNIP3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to BNIP3/NIP3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV001131 | Human BNIP3 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV001131 |
Gene Name | BNIP3 |
Accession Number | NM_004052 |
Gene ID | 664 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 780 bp |
Gene Alias | NIP3 |
Fluorescent Reporter | |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGCGACGCGGCCGCAGATCCGCCCGGCCCCGCCCTGCCCTGTGAGTTCCTCCGGCCGGGCTGCGGGGCTCCGCTCAGTCCGGGAGCGCAGCTGGGCCGCGGCGCTCCGACCTCCGCTTTCCCACCGCCCGCAGCTGAAGCACATCCCGCAGCCCGGCGCGGACTCCGATCGCCGCAGTTGCCCTCTGGCGCCATGTCGCAGAACGGAGCGCCCGGGATGCAGGAGGAGAGCCTGCAGGGCTCCTGGGTAGAACTGCACTTCAGCAATAATGGGAACGGGGGCAGCGTTCCAGCCTCGGTTTCTATTTATAATGGAGACATGGAAAAAATACTGCTGGACGCACAGCATGAGTCTGGACGGAGTAGCTCCAAGAGCTCTCACTGTGACAGCCCACCTCGCTCGCAGACACCACAAGATACCAACAGAGCTTCTGAAACAGATACCCATAGCATTGGAGAGAAAAACAGCTCACAGTCTGAGGAAGATGATATTGAAAGAAGGAAAGAAGTTGAAAGCATCTTGAAGAAAAACTCAGATTGGATATGGGATTGGTCAAGTCGGCCGGAAAATATTCCCCCCAAGGAGTTCCTCTTTAAACACCCGAAGCGCACGGCCACCCTCAGCATGAGGAACACGAGCGTCATGAAGAAAGGGGGCATATTCTCTGCAGAATTTCTGAAAGTTTTCCTTCCATCTCTGCTGCTCTCTCATTTGCTGGCCATCGGATTGGGGATCTATATTGGAAGGCGTCTGACAACCTCCACCAGCACCTTTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0426-Ab | Anti-BNIP3 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0426-Ag | BNIP3 protein |
ORF Viral Vector | pGMLV001131 | Human BNIP3 Lentivirus plasmid |
ORF Viral Vector | pGMAD000162 | Human BNIP3 Adenovirus plasmid |
ORF Viral Vector | pGMPC000183 | Human BNIP3 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLPm004024 | Mouse BNIP3 Lentivirus plasmid |
ORF Viral Vector | pGMLP-SPh-116 | Human BNIP3 Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-256 | Human BNIP3 Adenovirus plasmid |
ORF Viral Vector | vGMLV001131 | Human BNIP3 Lentivirus particle |
ORF Viral Vector | vGMAD000162 | Human BNIP3 Adenovirus particle |
ORF Viral Vector | vGMLPm004024 | Mouse BNIP3 Lentivirus particle |
ORF Viral Vector | vGMLP-SPh-116 | Human BNIP3 Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-256 | Human BNIP3 Adenovirus particle |
Target information
Target ID | GM-IP0426 |
Target Name | BNIP3 |
Gene ID | 664, 12176, 100426120, 84480, 768094, 607408, 615342, 100051673 |
Gene Symbol and Synonyms | BNIP3,HABON,NIP3 |
Uniprot Accession | Q12983 |
Uniprot Entry Name | BNIP3_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Cancer |
Gene Ensembl | ENSG00000176171 |
Target Classification | Tumor-associated antigen (TAA) |
This gene is encodes a mitochondrial protein that contains a BH3 domain and acts as a pro-apoptotic factor. The encoded protein interacts with anti-apoptotic proteins, including the E1B 19 kDa protein and Bcl2. This gene is silenced in tumors by DNA methylation. [provided by RefSeq, Dec 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.