Human ANTXR1/ATR/GAPO ORF/cDNA clone-Adenovirus plasmid (NM_018153)

Cat. No.: pGMAP-SPh-285
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ANTXR1/ATR/GAPO adenoviral expression plasmid for ANTXR1 adenovirus packaging, ANTXR1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.


Target products collection

Go to ANTXR1/ATR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP-SPh-285
Gene Name ANTXR1
Accession Number NM_018153
Gene ID 84168
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 1002 bp
Gene Alias ATR,GAPO,TEM8
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCACGGCGGAGCGGAGAGCCCTCGGCATCGGCTTCCAGTGGCTCTCTTTGGCCACTCTGGTGCTCATCTGCGCCGGGCAAGGGGGACGCAGGGAGGATGGGGGTCCAGCCTGCTACGGCGGATTTGACCTGTACTTCATTTTGGACAAATCAGGAAGTGTGCTGCACCACTGGAATGAAATCTATTACTTTGTGGAACAGTTGGCTCACAAATTCATCAGCCCACAGTTGAGAATGTCCTTTATTGTTTTCTCCACCCGAGGAACAACCTTAATGAAACTGACAGAAGACAGAGAACAAATCCGTCAAGGCCTAGAAGAACTCCAGAAAGTTCTGCCAGGAGGAGACACTTACATGCATGAAGGATTTGAAAGGGCCAGTGAGCAGATTTATTATGAAAACAGACAAGGGTACAGGACAGCCAGCGTCATCATTGCTTTGACTGATGGAGAACTCCATGAAGATCTCTTTTTCTATTCAGAGAGGGAGGCTAATAGGTCTCGAGATCTTGGTGCAATTGTTTACTGTGTTGGTGTGAAAGATTTCAATGAGACACAGCTGGCCCGGATTGCGGACAGTAAGGATCATGTGTTTCCCGTGAATGACGGCTTTCAGGCTCTGCAAGGCATCATCCACTCAATTTTGAAGAAGTCCTGCATCGAAATTCTAGCAGCTGAACCATCCACCATATGTGCAGGAGAGTCATTTCAAGTTGTCGTGAGAGGAAACGGCTTCCGACATGCCCGCAACGTGGACAGGGTCCTCTGCAGCTTCAAGATCAATGACTCGGTCACACTCAATGAGAAGCCCTTTTCTGTGGAAGATACTTATTTACTGTGTCCAGCGCCTATCTTAAAAGAAGTTGGCATGAAAGCTGCACTCCAGGTCAGCATGAACGATGGCCTCTCTTTTATCTCCAGTTCTGTCATCATCACCACCACACACTGTAGCCTCCACAAAATTGCATCAGGCCCCACAACAGCTGCTTGCATGGAATAG
ORF Protein Sequence MATAERRALGIGFQWLSLATLVLICAGQGGRREDGGPACYGGFDLYFILDKSGSVLHHWNEIYYFVEQLAHKFISPQLRMSFIVFSTRGTTLMKLTEDREQIRQGLEELQKVLPGGDTYMHEGFERASEQIYYENRQGYRTASVIIALTDGELHEDLFFYSEREANRSRDLGAIVYCVGVKDFNETQLARIADSKDHVFPVNDGFQALQGIIHSILKKSCIEILAAEPSTICAGESFQVVVRGNGFRHARNVDRVLCSFKINDSVTLNEKPFSVEDTYLLCPAPILKEVGMKAALQVSMNDGLSFISSSVIITTTHCSLHKIASGPTTAACME

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0068-Ab Anti-ANTR1/ ANTXR1/ ATR monoclonal antibody
    Target Antigen GM-Tg-g-MP0068-Ag ANTXR1 VLP (virus-like particle)
    ORF Viral Vector pGMLP002713 Human ANTXR1 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-285 Human ANTXR1 Adenovirus plasmid
    ORF Viral Vector vGMLP002713 Human ANTXR1 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-285 Human ANTXR1 Adenovirus particle


    Target information

    Target ID GM-MP0068
    Target Name ANTXR1
    Gene ID 84168, 69538, 100425392, 362393, 101092930, 612601, 616010, 100061334
    Gene Symbol and Synonyms 2310008J16Rik,2810405N18Rik,Antrx1,ANTXR1,ATR,GAPO,TEM8
    Uniprot Accession Q9H6X2
    Uniprot Entry Name ANTR1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000169604
    Target Classification Not Available

    This gene encodes a type I transmembrane protein and is a tumor-specific endothelial marker that has been implicated in colorectal cancer. The encoded protein has been shown to also be a docking protein or receptor for Bacillus anthracis toxin, the causative agent of the disease, anthrax. The binding of the protective antigen (PA) component, of the tripartite anthrax toxin, to this receptor protein mediates delivery of toxin components to the cytosol of cells. Once inside the cell, the other two components of anthrax toxin, edema factor (EF) and lethal factor (LF) disrupt normal cellular processes. Three alternatively spliced variants that encode different protein isoforms have been described. [provided by RefSeq, Oct 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.