Human ANTXR1/ATR/GAPO ORF/cDNA clone-Adenovirus particle (NM_018153)
Cat. No.: vGMAP-SPh-285
Pre-made Human ANTXR1/ATR/GAPO Adenovirus for ANTXR1 overexpression in-vitro and in-vivo. The ANTXR1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified ANTXR1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
ANTXR1/ATR products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP-SPh-285 | Human ANTXR1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP-SPh-285 |
| Gene Name | ANTXR1 |
| Accession Number | NM_018153 |
| Gene ID | 84168 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 1002 bp |
| Gene Alias | ATR,GAPO,TEM8 |
| Fluorescent Reporter | EGFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCCACGGCGGAGCGGAGAGCCCTCGGCATCGGCTTCCAGTGGCTCTCTTTGGCCACTCTGGTGCTCATCTGCGCCGGGCAAGGGGGACGCAGGGAGGATGGGGGTCCAGCCTGCTACGGCGGATTTGACCTGTACTTCATTTTGGACAAATCAGGAAGTGTGCTGCACCACTGGAATGAAATCTATTACTTTGTGGAACAGTTGGCTCACAAATTCATCAGCCCACAGTTGAGAATGTCCTTTATTGTTTTCTCCACCCGAGGAACAACCTTAATGAAACTGACAGAAGACAGAGAACAAATCCGTCAAGGCCTAGAAGAACTCCAGAAAGTTCTGCCAGGAGGAGACACTTACATGCATGAAGGATTTGAAAGGGCCAGTGAGCAGATTTATTATGAAAACAGACAAGGGTACAGGACAGCCAGCGTCATCATTGCTTTGACTGATGGAGAACTCCATGAAGATCTCTTTTTCTATTCAGAGAGGGAGGCTAATAGGTCTCGAGATCTTGGTGCAATTGTTTACTGTGTTGGTGTGAAAGATTTCAATGAGACACAGCTGGCCCGGATTGCGGACAGTAAGGATCATGTGTTTCCCGTGAATGACGGCTTTCAGGCTCTGCAAGGCATCATCCACTCAATTTTGAAGAAGTCCTGCATCGAAATTCTAGCAGCTGAACCATCCACCATATGTGCAGGAGAGTCATTTCAAGTTGTCGTGAGAGGAAACGGCTTCCGACATGCCCGCAACGTGGACAGGGTCCTCTGCAGCTTCAAGATCAATGACTCGGTCACACTCAATGAGAAGCCCTTTTCTGTGGAAGATACTTATTTACTGTGTCCAGCGCCTATCTTAAAAGAAGTTGGCATGAAAGCTGCACTCCAGGTCAGCATGAACGATGGCCTCTCTTTTATCTCCAGTTCTGTCATCATCACCACCACACACTGTAGCCTCCACAAAATTGCATCAGGCCCCACAACAGCTGCTTGCATGGAATAG |
| ORF Protein Sequence | MATAERRALGIGFQWLSLATLVLICAGQGGRREDGGPACYGGFDLYFILDKSGSVLHHWNEIYYFVEQLAHKFISPQLRMSFIVFSTRGTTLMKLTEDREQIRQGLEELQKVLPGGDTYMHEGFERASEQIYYENRQGYRTASVIIALTDGELHEDLFFYSEREANRSRDLGAIVYCVGVKDFNETQLARIADSKDHVFPVNDGFQALQGIIHSILKKSCIEILAAEPSTICAGESFQVVVRGNGFRHARNVDRVLCSFKINDSVTLNEKPFSVEDTYLLCPAPILKEVGMKAALQVSMNDGLSFISSSVIITTTHCSLHKIASGPTTAACME |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP0068-Ab | Anti-ANTR1/ ANTXR1/ ATR monoclonal antibody |
| Target Antigen | GM-Tg-g-MP0068-Ag | ANTXR1 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP002713 | Human ANTXR1 Lentivirus plasmid |
| ORF Viral Vector | pGMAP-SPh-285 | Human ANTXR1 Adenovirus plasmid |
| ORF Viral Vector | vGMLP002713 | Human ANTXR1 Lentivirus particle |
| ORF Viral Vector | vGMAP-SPh-285 | Human ANTXR1 Adenovirus particle |
Target information
| Target ID | GM-MP0068 |
| Target Name | ANTXR1 |
| Gene ID | 84168, 69538, 100425392, 362393, 101092930, 612601, 616010, 100061334 |
| Gene Symbol and Synonyms | 2310008J16Rik,2810405N18Rik,Antrx1,ANTXR1,ATR,GAPO,TEM8 |
| Uniprot Accession | Q9H6X2 |
| Uniprot Entry Name | ANTR1_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000169604 |
| Target Classification | Not Available |
This gene encodes a type I transmembrane protein and is a tumor-specific endothelial marker that has been implicated in colorectal cancer. The encoded protein has been shown to also be a docking protein or receptor for Bacillus anthracis toxin, the causative agent of the disease, anthrax. The binding of the protective antigen (PA) component, of the tripartite anthrax toxin, to this receptor protein mediates delivery of toxin components to the cytosol of cells. Once inside the cell, the other two components of anthrax toxin, edema factor (EF) and lethal factor (LF) disrupt normal cellular processes. Three alternatively spliced variants that encode different protein isoforms have been described. [provided by RefSeq, Oct 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


