Human ANTXR1/ATR/GAPO ORF/cDNA clone-Lentivirus particle (NM_018153)
Cat. No.: vGMLP002713
Pre-made Human ANTXR1/ATR/GAPO Lentiviral expression plasmid for ANTXR1 lentivirus packaging, ANTXR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
ANTXR1/ATR products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002713 | Human ANTXR1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002713 |
Gene Name | ANTXR1 |
Accession Number | NM_018153 |
Gene ID | 84168 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1002 bp |
Gene Alias | ATR,GAPO,TEM8 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCCACGGCGGAGCGGAGAGCCCTCGGCATCGGCTTCCAGTGGCTCTCTTTGGCCACTCTGGTGCTCATCTGCGCCGGGCAAGGGGGACGCAGGGAGGATGGGGGTCCAGCCTGCTACGGCGGATTTGACCTGTACTTCATTTTGGACAAATCAGGAAGTGTGCTGCACCACTGGAATGAAATCTATTACTTTGTGGAACAGTTGGCTCACAAATTCATCAGCCCACAGTTGAGAATGTCCTTTATTGTTTTCTCCACCCGAGGAACAACCTTAATGAAACTGACAGAAGACAGAGAACAAATCCGTCAAGGCCTAGAAGAACTCCAGAAAGTTCTGCCAGGAGGAGACACTTACATGCATGAAGGATTTGAAAGGGCCAGTGAGCAGATTTATTATGAAAACAGACAAGGGTACAGGACAGCCAGCGTCATCATTGCTTTGACTGATGGAGAACTCCATGAAGATCTCTTTTTCTATTCAGAGAGGGAGGCTAATAGGTCTCGAGATCTTGGTGCAATTGTTTACTGTGTTGGTGTGAAAGATTTCAATGAGACACAGCTGGCCCGGATTGCGGACAGTAAGGATCATGTGTTTCCCGTGAATGACGGCTTTCAGGCTCTGCAAGGCATCATCCACTCAATTTTGAAGAAGTCCTGCATCGAAATTCTAGCAGCTGAACCATCCACCATATGTGCAGGAGAGTCATTTCAAGTTGTCGTGAGAGGAAACGGCTTCCGACATGCCCGCAACGTGGACAGGGTCCTCTGCAGCTTCAAGATCAATGACTCGGTCACACTCAATGAGAAGCCCTTTTCTGTGGAAGATACTTATTTACTGTGTCCAGCGCCTATCTTAAAAGAAGTTGGCATGAAAGCTGCACTCCAGGTCAGCATGAACGATGGCCTCTCTTTTATCTCCAGTTCTGTCATCATCACCACCACACACTGTAGCCTCCACAAAATTGCATCAGGCCCCACAACAGCTGCTTGCATGGAATAG |
ORF Protein Sequence | MATAERRALGIGFQWLSLATLVLICAGQGGRREDGGPACYGGFDLYFILDKSGSVLHHWNEIYYFVEQLAHKFISPQLRMSFIVFSTRGTTLMKLTEDREQIRQGLEELQKVLPGGDTYMHEGFERASEQIYYENRQGYRTASVIIALTDGELHEDLFFYSEREANRSRDLGAIVYCVGVKDFNETQLARIADSKDHVFPVNDGFQALQGIIHSILKKSCIEILAAEPSTICAGESFQVVVRGNGFRHARNVDRVLCSFKINDSVTLNEKPFSVEDTYLLCPAPILKEVGMKAALQVSMNDGLSFISSSVIITTTHCSLHKIASGPTTAACME |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0068-Ab | Anti-ANTR1/ ANTXR1/ ATR monoclonal antibody |
Target Antigen | GM-Tg-g-MP0068-Ag | ANTXR1 VLP (virus-like particle) |
ORF Viral Vector | pGMLP002713 | Human ANTXR1 Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-285 | Human ANTXR1 Adenovirus plasmid |
ORF Viral Vector | vGMLP002713 | Human ANTXR1 Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-285 | Human ANTXR1 Adenovirus particle |
Target information
Target ID | GM-MP0068 |
Target Name | ANTXR1 |
Gene ID | 84168, 69538, 100425392, 362393, 101092930, 612601, 616010, 100061334 |
Gene Symbol and Synonyms | 2310008J16Rik,2810405N18Rik,Antrx1,ANTXR1,ATR,GAPO,TEM8 |
Uniprot Accession | Q9H6X2 |
Uniprot Entry Name | ANTR1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000169604 |
Target Classification | Not Available |
This gene encodes a type I transmembrane protein and is a tumor-specific endothelial marker that has been implicated in colorectal cancer. The encoded protein has been shown to also be a docking protein or receptor for Bacillus anthracis toxin, the causative agent of the disease, anthrax. The binding of the protective antigen (PA) component, of the tripartite anthrax toxin, to this receptor protein mediates delivery of toxin components to the cytosol of cells. Once inside the cell, the other two components of anthrax toxin, edema factor (EF) and lethal factor (LF) disrupt normal cellular processes. Three alternatively spliced variants that encode different protein isoforms have been described. [provided by RefSeq, Oct 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.