Human CTSG/CG/ MGC23078 ORF/cDNA clone-Adenovirus plasmid (BC014460)

Pre-made Human CTSG/CG/ MGC23078 adenoviral expression plasmid for CTSG adenovirus packaging, CTSG adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to CTSG/CG products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000076 Human CTSG Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000076
Gene Name CTSG
Accession Number BC014460
Gene ID 1511
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 768 bp
Gene Alias CG, MGC23078
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAGCCACTCCTGCTTCTGCTGGCCTTTCTCCTACCCACTGGGGCTGAGGCAGGGGAGATCATCGGAGGCCGGGAGAGCAGGCCCCACTCCCGCCCCTACATGGCGTATCTTCAGATCCAGAGTCCAGCAGGTCAGAGCAGATGTGGAGGGTTCCTGGTGCGAGAAGACTTTGTGCTGACAGCAGCTCATTGCTGGGGAAGCAATATAAATGTCACCCTGGGCGCCCACAATATCCAGAGACGGGAAAACACCCAGCAACACATCACTGCGCGCAGAGCCATCCGCCACCCTCAATATAATCAGCGGACCATCCAGAATGACATCATGTTATTGCAGCTGAGCAGAAGAGTCAGACGGAATCGAAACGTGAACCCAGTGGCTCTGCCTAGAGCCCAGGAGGGACTGAGACCCGGGACGCTGTGCACTGTGGCCGGCTGGGGCAGGGTCAGCATGAGGAGGGGAACAGATACACTCCGAGAGGTGCAGCTGAGAGTGCAGAGGGATAGGCAGTGCCTCCGCATCTTCGGTTCCTACGACCCCCGAAGGCAGATTTGTGTGGGGGACCGGCGGGAACGGAAGGCTGCCTTCAAGGGGGATTCCGGAGGCCCCCTGCTGTGTAACAATGTGGCCCACGGCATCGTCTCCTATGGAAAGTCGTCAGGGGTTCCTCCAGAAGTCTTCACCAGGGTCTCAAGTTTCCTGCCCTGGATAAGGACAACAATGAGAAGCTTCAAACTGCTGGATCAGATGGAGACCCCCCTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T86385-Ab Anti-CATG/ CTSG/ CG monoclonal antibody
    Target Antigen GM-Tg-g-T86385-Ag CTSG VLP (virus-like particle)
    ORF Viral Vector pGMAP000076 Human CTSG Adenovirus plasmid
    ORF Viral Vector vGMAP000076 Human CTSG Adenovirus particle


    Target information

    Target ID GM-T86385
    Target Name CTSG
    Gene ID 1511, 13035, 716440, 101098719, 106559147
    Gene Symbol and Synonyms CATG,CG,CTSG,VSP
    Uniprot Accession P08311
    Uniprot Entry Name CATG_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Diagnostics Biomarker
    Disease Not Available
    Gene Ensembl ENSG00000100448
    Target Classification Not Available

    The protein encoded by this gene, a member of the peptidase S1 protein family, is found in azurophil granules of neutrophilic polymorphonuclear leukocytes. The encoded protease has a specificity similar to that of chymotrypsin C, and may participate in the killing and digestion of engulfed pathogens, and in connective tissue remodeling at sites of inflammation. In addition, the encoded protein is antimicrobial, with bacteriocidal activity against S. aureus and N. gonorrhoeae. Transcript variants utilizing alternative polyadenylation signals exist for this gene. [provided by RefSeq, Sep 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.