Human CTSG/CG/MGC23078 ORF/cDNA clone-Adenovirus particle (BC014460)

Cat. No.: vGMAP000076

Pre-made Human CTSG/CG/MGC23078 Adenovirus for CTSG overexpression in-vitro and in-vivo. The CTSG adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CTSG-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to CTSG/CG products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000076 Human CTSG Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000076
Gene Name CTSG
Accession Number BC014460
Gene ID 1511
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 768 bp
Gene Alias CG,MGC23078
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGCAGCCACTCCTGCTTCTGCTGGCCTTTCTCCTACCCACTGGGGCTGAGGCAGGGGAGATCATCGGAGGCCGGGAGAGCAGGCCCCACTCCCGCCCCTACATGGCGTATCTTCAGATCCAGAGTCCAGCAGGTCAGAGCAGATGTGGAGGGTTCCTGGTGCGAGAAGACTTTGTGCTGACAGCAGCTCATTGCTGGGGAAGCAATATAAATGTCACCCTGGGCGCCCACAATATCCAGAGACGGGAAAACACCCAGCAACACATCACTGCGCGCAGAGCCATCCGCCACCCTCAATATAATCAGCGGACCATCCAGAATGACATCATGTTATTGCAGCTGAGCAGAAGAGTCAGACGGAATCGAAACGTGAACCCAGTGGCTCTGCCTAGAGCCCAGGAGGGACTGAGACCCGGGACGCTGTGCACTGTGGCCGGCTGGGGCAGGGTCAGCATGAGGAGGGGAACAGATACACTCCGAGAGGTGCAGCTGAGAGTGCAGAGGGATAGGCAGTGCCTCCGCATCTTCGGTTCCTACGACCCCCGAAGGCAGATTTGTGTGGGGGACCGGCGGGAACGGAAGGCTGCCTTCAAGGGGGATTCCGGAGGCCCCCTGCTGTGTAACAATGTGGCCCACGGCATCGTCTCCTATGGAAAGTCGTCAGGGGTTCCTCCAGAAGTCTTCACCAGGGTCTCAAGTTTCCTGCCCTGGATAAGGACAACAATGAGAAGCTTCAAACTGCTGGATCAGATGGAGACCCCCCTGTGA
ORF Protein Sequence MQPLLLLLAFLLPTGAEAGEIIGGRESRPHSRPYMAYLQIQSPAGQSRCGGFLVREDFVLTAAHCWGSNINVTLGAHNIQRRENTQQHITARRAIRHPQYNQRTIQNDIMLLQLSRRVRRNRNVNPVALPRAQEGLRPGTLCTVAGWGRVSMRRGTDTLREVQLRVQRDRQCLRIFGSYDPRRQICVGDRRERKAAFKGDSGGPLLCNNVAHGIVSYGKSSGVPPEVFTRVSSFLPWIRTTMRSFKLLDQMETPL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T86385-Ab Anti-CATG/ CTSG/ CG monoclonal antibody
    Target Antigen GM-Tg-g-T86385-Ag CTSG VLP (virus-like particle)
    ORF Viral Vector pGMAP000076 Human CTSG Adenovirus plasmid
    ORF Viral Vector vGMAP000076 Human CTSG Adenovirus particle


    Target information

    Target ID GM-T86385
    Target Name CTSG
    Gene ID 1511, 13035, 716440, 101098719, 106559147
    Gene Symbol and Synonyms CATG,CG,CTSG,VSP
    Uniprot Accession P08311
    Uniprot Entry Name CATG_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Diagnostics Biomarker
    Disease Not Available
    Gene Ensembl ENSG00000100448
    Target Classification Not Available

    The protein encoded by this gene, a member of the peptidase S1 protein family, is found in azurophil granules of neutrophilic polymorphonuclear leukocytes. The encoded protease has a specificity similar to that of chymotrypsin C, and may participate in the killing and digestion of engulfed pathogens, and in connective tissue remodeling at sites of inflammation. In addition, the encoded protein is antimicrobial, with bacteriocidal activity against S. aureus and N. gonorrhoeae. Transcript variants utilizing alternative polyadenylation signals exist for this gene. [provided by RefSeq, Sep 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.