Human FHIT/AP3Aase/ FRA3B ORF/cDNA clone-Adenovirus plasmid (BC032336)
Pre-made Human FHIT/AP3Aase/ FRA3B adenoviral expression plasmid for FHIT adenovirus packaging, FHIT adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to FHIT/AP3Aase products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000114 | Human FHIT Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000114 |
Gene Name | FHIT |
Accession Number | BC032336 |
Gene ID | 2272 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 444 bp |
Gene Alias | AP3Aase, FRA3B |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCGTTCAGATTTGGCCAACATCTCATCAAGCCCTCTGTAGTGTTTCTCAAAACAGAACTGTCCTTCGCTCTTGTGAATAGGAAACCTGTGGTACCAGGACATGTCCTTGTGTGCCCGCTGCGGCCAGTGGAGCGCTTCCATGACCTGCGTCCTGATGAAGTGGCCGATTTGTTTCAGACGACCCAGAGAGTCGGGACAGTGGTGGAAAAACATTTCCATGGGACCTCTCTCACCTTTTCCATGCAGGATGGCCCCGAAGCCGGACAGACTGTGAAGCACGTTCACGTCCATGTTCTTCCCAGGAAGGCTGGAGACTTTCACAGGAATGACAGCATCTATGAGGAGCTCCAGAAACATGACAAGGAGGACTTTCCTGCCTCTTGGAGATCAGAGGAGGAAATGGCAGCAGAAGCCGCAGCTCTGCGGGTCTACTTTCAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T59720-Ab | Anti-FHIT/ AP3Aase/ FRA3B monoclonal antibody |
Target Antigen | GM-Tg-g-T59720-Ag | FHIT VLP (virus-like particle) |
ORF Viral Vector | pGMAP000114 | Human FHIT Adenovirus plasmid |
ORF Viral Vector | vGMAP000114 | Human FHIT Adenovirus particle |
Target information
Target ID | GM-T59720 |
Target Name | FHIT |
Gene ID | 2272, 14198, 700974, 60398, 101082731, 100215999, 692183, 100057165 |
Gene Symbol and Synonyms | AP3Aase,FHIT,Fra14A2,FRA3B |
Uniprot Accession | P49789 |
Uniprot Entry Name | FHIT_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Lung Cancer |
Gene Ensembl | ENSG00000189283 |
Target Classification | Not Available |
The protein encoded by this gene is a P1-P3-bis(5'-adenosyl) triphosphate hydrolase involved in purine metabolism. This gene encompasses the common fragile site FRA3B on chromosome 3, where carcinogen-induced damage can lead to translocations and aberrant transcripts. In fact, aberrant transcripts from this gene have been found in about half of all esophageal, stomach, and colon carcinomas. The encoded protein is also a tumor suppressor, as loss of its activity results in replication stress and DNA damage. [provided by RefSeq, Aug 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.