Human FHIT/AP3Aase/ FRA3B ORF/cDNA clone-Adenovirus plasmid (BC032336)

Pre-made Human FHIT/AP3Aase/ FRA3B adenoviral expression plasmid for FHIT adenovirus packaging, FHIT adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to FHIT/AP3Aase products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000114 Human FHIT Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000114
Gene Name FHIT
Accession Number BC032336
Gene ID 2272
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 444 bp
Gene Alias AP3Aase, FRA3B
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCGTTCAGATTTGGCCAACATCTCATCAAGCCCTCTGTAGTGTTTCTCAAAACAGAACTGTCCTTCGCTCTTGTGAATAGGAAACCTGTGGTACCAGGACATGTCCTTGTGTGCCCGCTGCGGCCAGTGGAGCGCTTCCATGACCTGCGTCCTGATGAAGTGGCCGATTTGTTTCAGACGACCCAGAGAGTCGGGACAGTGGTGGAAAAACATTTCCATGGGACCTCTCTCACCTTTTCCATGCAGGATGGCCCCGAAGCCGGACAGACTGTGAAGCACGTTCACGTCCATGTTCTTCCCAGGAAGGCTGGAGACTTTCACAGGAATGACAGCATCTATGAGGAGCTCCAGAAACATGACAAGGAGGACTTTCCTGCCTCTTGGAGATCAGAGGAGGAAATGGCAGCAGAAGCCGCAGCTCTGCGGGTCTACTTTCAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T59720-Ab Anti-FHIT/ AP3Aase/ FRA3B monoclonal antibody
    Target Antigen GM-Tg-g-T59720-Ag FHIT VLP (virus-like particle)
    ORF Viral Vector pGMAP000114 Human FHIT Adenovirus plasmid
    ORF Viral Vector vGMAP000114 Human FHIT Adenovirus particle


    Target information

    Target ID GM-T59720
    Target Name FHIT
    Gene ID 2272, 14198, 700974, 60398, 101082731, 100215999, 692183, 100057165
    Gene Symbol and Synonyms AP3Aase,FHIT,Fra14A2,FRA3B
    Uniprot Accession P49789
    Uniprot Entry Name FHIT_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Lung Cancer
    Gene Ensembl ENSG00000189283
    Target Classification Not Available

    The protein encoded by this gene is a P1-P3-bis(5'-adenosyl) triphosphate hydrolase involved in purine metabolism. This gene encompasses the common fragile site FRA3B on chromosome 3, where carcinogen-induced damage can lead to translocations and aberrant transcripts. In fact, aberrant transcripts from this gene have been found in about half of all esophageal, stomach, and colon carcinomas. The encoded protein is also a tumor suppressor, as loss of its activity results in replication stress and DNA damage. [provided by RefSeq, Aug 2017]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.