Human FHIT/AP3Aase/ FRA3B ORF/cDNA clone-Adenovirus particle (BC032336)
Pre-made Human FHIT/AP3Aase/ FRA3B Adenovirus for FHIT overexpression in-vitro and in-vivo. The FHIT adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified FHIT-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to FHIT/AP3Aase products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000114 | Human FHIT Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000114 |
Gene Name | FHIT |
Accession Number | BC032336 |
Gene ID | 2272 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 444 bp |
Gene Alias | AP3Aase, FRA3B |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCGTTCAGATTTGGCCAACATCTCATCAAGCCCTCTGTAGTGTTTCTCAAAACAGAACTGTCCTTCGCTCTTGTGAATAGGAAACCTGTGGTACCAGGACATGTCCTTGTGTGCCCGCTGCGGCCAGTGGAGCGCTTCCATGACCTGCGTCCTGATGAAGTGGCCGATTTGTTTCAGACGACCCAGAGAGTCGGGACAGTGGTGGAAAAACATTTCCATGGGACCTCTCTCACCTTTTCCATGCAGGATGGCCCCGAAGCCGGACAGACTGTGAAGCACGTTCACGTCCATGTTCTTCCCAGGAAGGCTGGAGACTTTCACAGGAATGACAGCATCTATGAGGAGCTCCAGAAACATGACAAGGAGGACTTTCCTGCCTCTTGGAGATCAGAGGAGGAAATGGCAGCAGAAGCCGCAGCTCTGCGGGTCTACTTTCAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T59720-Ab | Anti-FHIT/ AP3Aase/ FRA3B monoclonal antibody |
Target Antigen | GM-Tg-g-T59720-Ag | FHIT VLP (virus-like particle) |
ORF Viral Vector | pGMAP000114 | Human FHIT Adenovirus plasmid |
ORF Viral Vector | vGMAP000114 | Human FHIT Adenovirus particle |
Target information
Target ID | GM-T59720 |
Target Name | FHIT |
Gene ID | 2272, 14198, 700974, 60398, 101082731, 100215999, 692183, 100057165 |
Gene Symbol and Synonyms | AP3Aase,FHIT,Fra14A2,FRA3B |
Uniprot Accession | P49789 |
Uniprot Entry Name | FHIT_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Lung Cancer |
Gene Ensembl | ENSG00000189283 |
Target Classification | Not Available |
The protein encoded by this gene is a P1-P3-bis(5'-adenosyl) triphosphate hydrolase involved in purine metabolism. This gene encompasses the common fragile site FRA3B on chromosome 3, where carcinogen-induced damage can lead to translocations and aberrant transcripts. In fact, aberrant transcripts from this gene have been found in about half of all esophageal, stomach, and colon carcinomas. The encoded protein is also a tumor suppressor, as loss of its activity results in replication stress and DNA damage. [provided by RefSeq, Aug 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.